Transcript asmbl_28580

Sequence
Transcript Sequence for observation asmbl_28580 of TGE0057167:
AGCAAGGGCTGCCCTGAAGGAAGCTCCAAAGAGAAAGGAGGGCAGGAAGCCCACGGCCCACAGGGGTGTAGCCCGAGACCCACCTGCAGCCCCCAGCCCTTGCCAGGAAAGCAGCAGCCGCAGCCATGGCGGGGATGAAGACAGCCTCCGGGGACTACATCGACTCGTCATGGGAGCTGCGGGTGTTTGTGGGAGAGGAGGACCCAGAGGCCGAGTCGGTCACCCTGCGGGTCACTGGGGAGTCGCACATCGGCGGGGTGCTCCTGAAGATTGTGGAGCAGATCAATCGCAAGCAGGACTGGTCAGACCATGCTATTTGGTGGGAACAGAAGAGGCAGTGGCTGCTGCAGACCCACTGGACACTGGACAAGTACGGGATCCTGGCCGACGCACGCCTCTTCTTTGGGCCCCAGCACCGGCCCGTCATCCTTCGGTTGCCCAACCGCCGCGCACTGCGCCTCCGTGCCAGCTTCTCCCAGCCCCTCTTCCAGGCTGTGGCTGCCATCTGCCGCCTCCTCAGCATCCGGCACCCCGAGGAGCTGTCCCTGCTCCGGGCTCCTGAGAAGAAGGAGAAGAAGAAGAAAGAGAAGGAGCCAGAGGAAGAGCTCTATGACTTGAGCAAGGTTGTCTTGGCTGGGGGCGTGGCACCTGCACTGTTCCGGGGGATGCCAGCTCACTTCTCGGACAGCGCCCAGACTGAGGCCTGCTACCACATGCTGAGCCGGCCCCAGCCGCCACCCGACCCCCTCCTGCTCCAGCGTCTGCCACGGCCCAGCTCCCTGTCAGACAAGACCCAGCTCCACAGCAGGTGGCTGGACTCGTCGCGGTGTCTCATGCAGCAGGGCATCAAGGCCGGGGACGCACTCTGGCTGCGCTTCAAGTACTACAGCTTCTTCGATTTGGATCCCAAGACAGACCCCGTGCGGCTGACACAGCTGTATGAGCAGGCCCGGTGGGACCTGCTGCTGGAGGAGATTGACTGCACCGAGGAGGAGATGATGGTGTTTGCCGCCCTGCAGTACCACATCAACAAGCTGTCCCAGAGCGGGGAGGTGGGGGAGCCGGCTGGCACAGACCCAGGGCTGGACGACCTGGATGTGGCCCTGAGCAACCTGGAGGTGAAGCTGGAGGGGTCGGCGCCCACAGATGTGCTGGACAGCCTCACCACCATCCCAGAGCTCAAGGACCATCTCCGAATCTTTCGGCCCCGGAAGCTGACCCTGAAGGGCTACCGCCAACACTGGGTGGTGTTCAAGGAGACCACACTGTCCTACTACAAGAGCCAGGACGAGGCCCCTGGGGACCCCATTCAGCAGCTCAACCTCAAGGGCTGTGAGGTGGTTCCCGATGTTAACGTCTCCGGCCAGAAGTTCTGCATTAAACTCCTAGTGCCCTCCCCTGAGGGCATGAGTGAGATCTACCTGCGGTGCCAGGATGAGCAGCAGTATGCCCGCTGGATGGCTGGCTGCCGCCTGGCCTCCAAAGGCCGCACCATGGCCGACAGCAGCTACACCAGCGAGGTGCAGGCCATCCTGGCCTTCCTCAGCCTGCAGCGCACGGGCAGTGGGGGCCCGGGCAACCACCCCCACGGCCCTGATGCCTCTGCCGAGGGCCTCAACCCCTACGGCCTCGTTGCCCCCCGTTTCCAGCGAAAGTTCAAGGCCAAGCAGCTCACCCCACGGATCCTGGAAGCCCACCAGAATGTGGCCCAGTTGTCGCTGGCAGAGGCCCAGCTGCGCTTCATCCAGGCCTGGCAGTCCCTGCCCGACTTCGGCATCTCCTATGTCATGGTCAGGTTCAAGGGCAGCAGGAAAGACGAGATCCTGGGCATCGCCAACAACCGACTGATCCGCATCGACTTGGCCGTGGGCGACGTGGTCAAGACCTGGCGTTTCAGCAACATGCGCCAGTGGAATGTCAACTGGGACATCCGGCAGGTGGCCATCGAGTTTGATGAACACATCAATGTGGCCTTCAGCTGCGTGTCTGCCAGCTGCCGAATTGTACACGAGTATATCGGGGGCTACATTTTCCTGTCGACGCGGGAGCGGGCCCGTGGGGAGGAGCTGGATGAAGACCTCTTCCTGCAGCTCACCGGGGGCCATGAGGCCTTCTGAGGGCTGTCTGATTGCCCCTGCCCTGCTCACCACCCTGTCACAGCCACTCCCAAGCCCACACCCACAGGGGCTCACTGCCCCACACCCGCTCCAGGCAGGCACCCAGCTGGGCATTTCACCTGCTGTCACTGACTTTGTGCAGGCCAAGGACCTGGCAGGGCCAGACGCTGTACCATCACCCAGGCCAGGGATGGGGGTGGGGGTCCCTGAGCTCATGTGGTGCCCCCTTTCCTTGTCTGAGTGGCTGAGGCTGATACCCCTGACCTATCTGCAGTCCCCCAGCACACAAGGAAGACCAGATGTAGCTACAGGATGATGAAACATGGTTTCAAACGAGTTCTTTCTTGTTACTTTTTAAAATTTCTTTTTTATAAATTAATATTTTATTGTTGGAT