Transcript asmbl_28157

Sequence
Transcript Sequence for observation asmbl_28157 of TGE0059110:
GTCCAACTTTAAAAAGTTGGGGGTGGTTTGTGTTGGGGAAGGCCTGCGATTGGACTGCAGAATCCACTAGGGAGGAGGAAAGCAAAAGTAAAAAGGAAATAGCTGGGGGAAGGGAACGGGGGGAAGCCATCTTCACCCCCCACCCCAATGCACACACAATTAAGCCAGGAAGCAGCTTGCAACCACTAGCCTGGGGAGGGTCCGCATGTGTCAAGGGTGAGGGCAACAGATGCTGGACCCAGGGAGCTCTCTGCCACAGGTCAGTCTACAAGGCCTCAGGGACCAACTTGCCAACAGCTGGACTTGATCACTAGCTGGCAAACTGAGCTCACGTATCGGGTGGAATAACAAGCGGACTTTGCTCTCTGCTGTGCAAAACGCTGTTTTTAGAGGATTTGCCACAGCAGCGGATAGAGCAGGAGAGCACCACCGGAGCCCTTGAGACATCCTTGAGAAGAGCCACAGCATAAGAGACTGCCCTGCTTGGTGTTTTGCAGGATGATGGTGGCCCTTCGAGGAGCTTCTGCATTGCTGGTTCTGTTCCTTGCAGCTTTTCTGCCCCCGCCGCAGTGTACCCAGGACCCAGCCATGGTGCATTACATCTACCAGCGCTTTCGAGTCTTGGAGCAAGGGCTGGAAAAATGTACCCAAGCAACGAGGGCATACATTCAAGAATTCCAAGAGTTCTCAAAAAATATATCTGTCATGCTGGGAAGATGTCAGACCTACACAAGTGAGTACAAGAGTGCAGTGGGTAACTTGGCACTGAGAGTTGAACGTGCCCAACGGGAGATTGACTACATACAATACCTTCGAGAGGCTGACGAGTGCATCGAATCAGAGGACAAGACACTGGCAGAAATGTTGCTCCAAGAAGCTGAAGAAGAGAAAAAGATCCGGACTCTGCTGAATGCAAGTAAGAAAACTGCATCTTTTCCTAGCCCTTCTAGGGACTATTATGCTCAGAAACACACAGACTCAGAGCAGTCAGGGAGCATCATAGAGTAATGAGAGTAAGAATTGGAGGTGTGCTTTTGTGTGCATTGCTGAGAGAGAAAGCTATACAGAGAACAGGTGTCCAAAGAGAAATCCATTCTCGCAAAGCCATTCTTTCTTTCACACACAGTGCCTAAAGCCTCCATAGATGGTGAAGGCTATAGTGCCAAAAGTCAGCCCAAAGAGACTACCTCCTGATAAATCTTGGTTTGGTGGAGATGTGTGGTCCCAGATTTTTTCAGGGAAAGTAGCAGTTTGGTGGATTCTACATCCAGTACCCAGGCTGTAGATAGCATCTGCAAATGTACCAAGAAACAGTCTTAAATTGGAAATGGCAACAGCCAACCCTCAGGGATGGGAACTGCAGTGAATCACTATTGTGTGTGCTGTCTGAGATGGTGATATGCATGGGATGTGGTCTAATCTTGTGATCCATCAGAATCACTTCCAAGCCATTAAGAATAATGTGTAGCAGCTCAAATTATAATAAACAGTATCAGGCAATAAACACACAAAT