Transcript asmbl_28150

Sequence
Transcript Sequence for observation asmbl_28150 of TGE0056169:
CGGATAGGGTCTAGTTGCCTGCTCTCGGACATCCGTTCAGCAGACACTACCTCTTCGTCACCCCCTGCCCACCCTGACCCGCCTTTACCTCGCGTCTAGAGGACACAGCCAGGGATCATCCCGCAGCCCCGAACTCCTTCACAGACCCCCACTAGCCGGGGACGCAGCTCAGGCCCCCTACCCCCAACACAAACACTTCTCTCCTGTAGAGGATAAAGCTTGGGGTTCATCCTCCTTCCCTGGATCACTCCACAGTCCTCAGGCTTCCCCAATCCAGGGGACTCGGCGCCGGGACGCTGCTATGGACGACATTTTCACTCAGTGCCGGGAGGGCAACGCAGTCGCCGTTCGCCTGTGGCTGGACAACACGGAGAACGACCTCAACCAGGGGGACGATCATGGCTTCTCCCCCTTGCACTGGGCCTGCCGAGAGGGCCGCTCTGCTGTGGTTGAGATGTTGATCATGCGGGGGGCACGGATCAATGTAATGAACCGTGGGGATGACACCCCCCTGCATCTGGCAGCCAGTCATGGACACCGTGATATTGTACAGAAGCTATTGCAGTACAAGGCAGACATCAATGCAGTGAATGAACACGGGAATGTGCCCCTGCACTATGCCTGTTTTTGGGGCCAAGATCAAGTGGCAGAGGACCTGGTGGCAAATGGGGCCCTTGTCAGCATCTGTAACAAGTATGGAGAGATGCCTGTGGACAAAGCCAAGGCACCCCTGAGAGAGCTTCTCCGAGAGCGGGCAGAGAAGATGGGCCAGAATCTCAACCGTATTCCATACAAGGACACATTCTGGAAGGGGACCACCCGCACTCGGCCCCGAAATGGAACCCTGAACAAACACTCTGGCATTGACTTCAAACAGCTTAACTTCCTGACGAAGCTCAACGAGAATCACTCTGGAGAGCTATGGAAGGGCCGCTGGCAGGGCAATGACATTGTCGTGAAGGTGCTGAAGGTTCGAGACTGGAGTACAAGGAAGAGCAGGGACTTCAATGAAGAGTGTCCCCGGCTCAGGATTTTCTCGCATCCAAATGTGCTCCCAGTGCTAGGTGCCTGCCAGTCTCCACCTGCTCCTCATCCTACTCTCATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAGGCCTTCGGCCTACCATCCCACCAGGTATTTCCCCTCATGTGTGTAAGCTCATGAAGATCTGCATGAATGAAGACCCTGCAAAGCGACCCAAATTTGACATGATTGTGCCTATCCTTGAGAAGATGCAGGACAAGTAGGACTGGAAGGTCCTTGCCTGAACTCCAGAGGTGTCGGGACATGGTTGGGGGAATGCACCTCCCCAAAGCAGCAGGCCTCTGGTTGCCTCCCCCGCCTCCAGTCATGGTACTACCCCAGCCATGGGGTCCATCCCCTTCCCCCATCCCTACCACTGTGGCCCCAAGAGGGGCGGGCTCAGAGCTTTGTCACTTGCCACATGGTGTCTCCCAACATGGGAGGGATCAGCCCCGCCTGTCACAATAAAGTTTATTATGAAAACA