Transcript asmbl_28149

Sequence
Transcript Sequence for observation asmbl_28149 of TGE0059615:
CGGGGCCGGCGGCGGGCTGCGGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGAGTCCCGTCCTCAGGCTTCCCCAATCCAGGGGACTCGGCGCCGGGACGCTGCTATGGACGACATTTTCACTCAGTGCCGGGAGGGCAACGCAGTCGCCGTTCGCCTGTGGCTGGACAACACGGAGAACGACCTCAACCAGGGGGACGATCATGGCTTCTCCCCCTTGCACTGGGCCTGCCGAGAGGGCCGCTCTGCTGTGGTTGAGATGTTGATCATGCGGGGGGCACGGATCAATGTAATGAACCGTGGGGATGACACCCCCCTGCATCTGGCAGCCAGTCATGGACACCGTGATATTGTACAGAAGCTATTGCAGTACAAGGCAGACATCAATGCAGTGAATGAACACGGGAATGTGCCCCTGCACTATGCCTGTTTTTGGGGCCAAGATCAAGTGGCAGAGGACCTGGTGGCAAATGGGGCCCTTGTCAGCATCTGTAACAAGTATGGAGAGATGCCTGTGGACAAAGCCAAGGCACCCCTGAGAGAGCTTCTCCGAGAGCGGGCAGAGAAGATGGGCCAGAATCTCAACCGTATTCCATACAAGGACACATTCTGGAAGGGGACCACCCGCACTCGGCCCCGAAATGGAACCCTGAACAAACACTCTGGCATTGACTTCAAACAGCTTAACTTCCTGACGAAGCTCAACGAGAATCACTCTGGAGAGCTATGGAAGGGCCGCTGGCAGGGCAATGACATTGTCGTGAAGGTGCTGAAGGTTCGAGACTGGAGTACAAGGAAGAGCAGGGACTTCAATGAAGAGTGTCCCCGGCTCAGGATTTTCTCGCATCCAAATGTGCTCCCAGTGCTAGGTGCCTGCCAGTCTCCACCTGCTCCTCATCCTACTCTCATCACACACTGGATGCCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTGAAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACATGCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAGTTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAGCCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACACGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAGGCCTTCGGCCTACCATCCCACCAGGTATTTCCCCTCATGTGTGTAAGCTCATGAAGATCTGCATGAATGAAGACCCTGCAAAGCGACCCAAATTTGACATGATTGTGCCTATCCTTGAGAAGATGCAGGACAAGTAGGACTGGAAGGTCCTTGCCTGAACTCCAGAGGTGTCGGGACATGGTTGGGGGAATGCACCTCCCCAAAGCAGCAGGCCTCTGGTTGCCTCCCCCGCCTCCAGTCATGGTACTACCCCAGCCATGGGGTCCATCCCCTTCCCCCATCCCTACCACTGTGGCCCCAAGAGGGGCGGGCTCAGAGCTTTGTCACTTGCCACATGGTGTCTCCCAACATGGGAGGGATCAGCCCCGCCTGTCACAATAAAGTTTATTATGAAAACA