Transcript asmbl_28079

Sequence
Transcript Sequence for observation asmbl_28079 of TGE0059613:
GGCCAGAGAGCGAGCGCGCAACGGCGGCGACGGCGGCGACCCCACCGCGCATCCTGCCAGGCCTCCGGCGCCCAGCGCCCCACGCGCCCCCGCGCCCCCGCGCCCCCGCGCCCCTTTCTTCGCGCCCCCGCCCCTCGGCCCGCCAGGCCCCCTTGCCGGCCACCCGCCAGGCCCCGCGCCGGCCCGCCCGCCGCCCAGGACCGGCCCGCGCCCCGCAGGCCGCCCGCCGCCCGCGCCGCCATGGGAGTGGAGGGCTGCACCAAGTGCATCAAGTACCTGCTCTTCGTCTTCAATTTCGTCTTCTGGCTGGCTGGAGGCGTGATCCTGGGTGTGGCCCTGTGGCTCCGCCATGACCCGCAGACCACCAACCTCCTGTATCTGGAGCTGGGAGACAAGCCCGCGCCCAACACCTTCTATGTAGGCATCTACATCCTCATCGCTGTGGGCGCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCATTGCTGCCATCGTGGTCGCTGTGATCATGATCTTCGAGATGATCCTGAGCATGGTGCTGTGCTGTGGCATCCGGAACAGCTCCGTGTACTGAGGCCCCGCAGCTCTGGCCACAGGGACCTCTGCAGTGCCCCCTAAGTGACCCGGACACTTCCGAGGGGGCCATCACCGCCTGTGTATATAACGTTTCCGGTATTACTCTGCTACACGTAGCCTTTTTACTTTTGGGGTTTTGTTTTTGTTCTGAACTTTCCTGTTACCTTTTCAGGGCTGACGTCACATGTAGGTGGCGTGTATGAGTGGAGACGGGCCTGGGTCTTGGGGACTGGAGGGCAGGGGTCCTTCTGCCCTGGGGTCCCAGGGTGCTCTGCCTGCTCAGCCAGGCCTCTCCTGGGAGCCACTCGCCCAGAGACTCAGCTTGGCCAACTTGGGGGGCTGTGTCCACCCAGCCCGCCCGTCCTGTGGGCTGCACAGCTCACCTTGTTCCCTCCTGCCCCGGTTCGAGAGCCGAGTCTGTGGGCACTCTCTGCCTTCATGCACCTGTCCTTTCTAACACGTCGCCTTCAACTGTAATCACAACATCCTGACTCCGTCATTTAATAAAGAAGGAACATCAGGCATGCTACCAGGCCTGTGCAGTCCCTCAGTGCCAGTGGTGTCTGAGACCTAGGGGTTGGCCGGAGGGCAGGGGAATCTGACATCGGTGGGGCTTGGCTCTGTGGACTCTGTGGGGTCCAGGGTGAGGGTGGGTGGGTCGGGATCCCTGGTGTTCACCAA