Transcript asmbl_27229

Sequence
Transcript Sequence for observation asmbl_27229 of TGE0056760:
ACAATCCTTTAATAAAATTAGTCCATCTAAAACTCCCCAATGCCTAAGGTTCTAGTCGTGGAAGGGTTAGCTGCAGAATTCCAGTTCAGAAGCCAACGGAGGCTCAGTCCAGACAGGGATTAACCGACTTGTGCTGGTATCTAGGTGCTTGGATTGCCGAGTTGAGTTTGCTGGAAGGGAAATGGGGCGGCGTCGGGGGGCCCGACAGGCCTGGCTGCCAGTCGGCTTCCGCGAAAACGACTCTTGCTGTCCACATAGCCAGCCGTGAAGCCAAACTGCAGGCCTCTGCCCTCCCCTAAATGTCCTCCTAGGAGGCAGTCACTCGGGAGGAAGATGTGCCTGTTACCAAGTGCTTCGTCCCGGCCCCAGCGCAGACCTATGAATGAAGATGGAGGGAGAGCTGATGTGAAAGGCCTGGGTCCCGGCCGCAGAAGGGGCGCCAGACCGAAATCGGCGATCGCGTCTCTCCCACCAAAGCCTCCCGGCCAGCGGCCGCGTCTGAAAGTCCTGGGCTAAGCACCACGCCGGGGGGGTACCAGACACCCCGGCTGCAGCTGCCGAGGGCCTCACTCACCTTCAGGGCCGCCGGCCTCTCGGCCTGGACTGCCCACCTCGGCCCTGCGTCAGAGCGGAAGGCCAAGTCTTCCAGAAGGTGCTGCGGCCTCCCCGCAGCCCCTTAGCGACTCGGGATGGGGCGGCTGAGTCACGAACGCCGAGGCGGGCAGGTGCGGCGCCGCCGGCCTCCCCCCGGCAGGCTCGGGTCTTCCGCGCCACGGAGGTCCCCGAAGAGCGCCCAAGCCGCATCCGGAAGGCCCGAACCCTACCGGAGGGCGGACGGCGGACAGGGCAGGGCCCGAGGCCGACGCGGCAGGCGGTGCGGGACGGGAGCGGGGGCGGGCGGGGACTCGAGGCCGGGCGGCGAAGGCGGGCGAGGGGAGGGGAGGGGAAGGGAGCCGCGGCCCGCTTGCCCCGCAGTCTGAAGCGGCTCAGCTCTTTCCATGAGGGCGGTGGTGGCCCTTAAAAGGGCCTTTGTGGTGGCATGGGGAGGCCTGGCGGCCGGCCGCGGCGCGGGCCCTCTTAGTACTCCTGGGAGGCCTGGGTGGCCTTCTTGCCGCCCGAGGGCGCCTTCGGCCCCACGGTGGCGCTGGTCTTCTTGGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCTCCCTGGGCGATCGTCACGCCGCCCAGCAGCTTGTTGAGCTCCTCGTCGTTGCGGATGGCCAGCTGCAGGTGGCGGGGGATGATTCGCGTCTTCTTGTTGTCGCGGGCCGCATTGCCCGCCAGCTCCAGGATCTCAGCGGTGAGGTACTCCAGCACTGCCGCCAGGTACACTGGCGCGCCGGCGCCAACGCGCTCGGCGTAGTGGCCCTTCCGCAGCAGCCGGTGTACACGGCCCACTGGGAACTGGAGGCCGGCGCGCGACGAGCGCGACTTGGCCTTGGCGCGGGCCTTGCCGCCAGTCTTGCCGCGGCCCGACATGCTAGCGAGGTAGACCGGTGAAGCACGACGGCTCAAACACTAGAACAGACGCCCGCCGCAGTGTAACTG