Transcript asmbl_24636

Sequence
Transcript Sequence for observation asmbl_24636 of TGE0058148:
TCAAGGTTAATAAACAGCTTTATTTGCCTTGTACAGCATCAATTTTCTTACATTCTCAGTTAATTGGCCATTAAAGTGCTGGAAATTTTCTTAATCATGATAACATTTGTTAAAAAGAAATCAGAACTAATATCAGGAACATGGCGGCATGAAGGAAACAGTTCCCTTACAAAACACAGAAAATGGAAGCCCCTCATGTTGAGGGGGTGGGTTGGACAATTTGCAAACAGATTCTAATTTCCTCTCACCGTCAGCACCAAACTGGCTGGGACCACCACCCCTGGGTGAAAGAAACAACACTAAAGAACCCTAAAAACACCCACACACCCTGACTACCACCACCTCTGGGCCATCTGTGGGCGTTTGCTGTTTGAACAGATCCAGTCTCAGGAAAGAGGAAGACCTGACCTCCGTCTGCAACCCATCACCCCACCCACCCTTACTAACAAAAGCCCCCAAAGTCATTACAATGAAAAAGTGGGTTTCCATTACCCCAAAACTAACAATGTTCAGTAAAAATGAGGATAATAAACACAAAAGCTTGCTTAGTAAACAGGAGCTCTCAGCAGTCAATGCAAAAAAATATATATATATGAAATCTTAAGGCAAATACTGTTGACTTTGCACATGGGCTGGACGAACTTGGAACTCTTTACCTATCTGTATAGTTCCAGGAGCCTACAGGCGGTCGGTTTTTCAGCGCTTGCCACCGGGCCAGGCAAGGTCTTTGCATGATTGCTGAGGCAGTCGGTGTGTTTCCCTTTGGAGTTTATATAGGAACACACCACCCAAGGCTGATGTTTTGTTATATATATATATATGTACACACATACAAAGGCCTGCTACTCTTTCTTTGTGGAAACTGACAGCTCCACCTCGGGAAGCTGGATGCCAACCTTATTCCCACTGTCATTGCTAGAAGAGGAGGACAGTCGGGACTTCTTAGAGGCCAGGGACACCCCACTCCCCTGTAACTTGCCTGTCTCATCATCGCTCCCAGTCACCTCATAATGACCTTTGCTCTTTGACCCCAATCCACCAAAGGTACCGAATTTCAGCTTCCCGTGTTTCCCTTTAACTTTCCCACCTTCCAGAGACACTTCCCCACCTTCAAACTCCAGCGTCCCCGTCGGGGTGGAAGGTCCAGAGAACTCTCTTTCATCACTGAATGAATTTGAGCGGTGCCGTGGCTTCTTACTTTTAAATAAGGAGAATTTGCCTTTCGGTGAAGAGGCTTCGGCCTCTGCCTCTCCTTCCAGAGAGCCCAGGCTGGCCTTTGAACTTTTCAGGTCACCTTTGGACCCAGAAATTGATGCTTCTGGTGAGCCAGTGACACCACCTTTCCCTTTAGGTTTGGAAAAATTAAACTTGGGCATTTTGATCTTGGACTTTTTCAGTTTGACTTCAGACTCTTCCCACTCGCCGTCTCCAGCACCAGCTTGGATGCTGGCCTCTGCTTTAGGGAAGTGAACATCCACCCCCATTTCTCTGCCAACCAGCTCACGGCCAGAGAAGGTAAATTTGGGGATCTTCATTTTAGGGAATGTTACTTTTCCAGATCCACTTTCCAAGTGACCTTGAGGCCCAGACACACTCAGCCCAGGAGCCTGGAGTCCAATCTGACCTCCTTTCACACCTCCTTCCACCTTTGGTCCTGAGAAATGAAGGCCCCCAGCAAACTTAGATGTGTCCAAGTTGAGAGCAGAGGAGACTTGGGGTCCCTTCCACTCACCCCCGGAACCTTTAACACTCAAATGCCCTTCACCAAGGCTGATGTCTGGGGCACTGACACCCCCTGAAACATCCGCACCTCCTTTGATTTTTGGGCCCTTCAAGTTGATGCCAAAATCTGACTCAGGAGATGCCATATTAAAGGCAGGCCCCTTCACACTGATATCAGGAGCAGCCCCATGGAAACCTACTTCTGAACCTTTCAGACCACCTTTGATTTCAGGCCCAGAAATCTGCCCAGTTGGGAGTTTCACATTCACGCCTGGCAGGTTCACATCACATCCAGAGGACTTAATTCCAGGCATCTGGAGGTTTCCTTCTAGGCCTTGAACACCAATGCCTGGAAGACCTCCTCCGACAGTGGGGCCTTTGATCTCACCAGTGGCCCCAAGGCTCCCTTTCACTTTTGGTCCTTCCAAGTTAAAGTCCACATTCGGTGCTGAAATCCGAGGCCCTTTCAGGTTCACATCCACACCTGGCCCCTTCAGTTCGCCAGAAACCTGTGGCCCCTTGGCATTGACGTGCAAGTCGGACCCCGGAGTAGAGATGCCAAATTGGGGCAGCTTCATTTTGGGAAGTTTAATGCTGCCTTCGGATGCCTCCAAGCTTAGATCAGGAGCTCCTACGGATACTTTAGGGCATTTGATGTCACCAGAGACAGCCAGATCTCCCTGCAGGCTTGGTCCCCTCAGTGTCACATCTGGTGCCCCAACGTTAAGCTTTGTTGTGGCATCGATCCCTGGCACTTTCACACCGTCTCCTCCCACCTGCATTTTGCCACCGACACCACTGAGGTTGAGCCCTGGAGCATGCACCTTCATGCTGGGAACAGATGCATCCAGGTCTCCCTTCAAACTTGGTCCTTTCAAGTTCAGATCAAGGTCAGGCCCAGAGACTTTTGGCATAGAGAGGTTCACTGAAGGCAAGTCTACTCCTGGCCCCTTTAGAGAAACATCGGGCCCTTCGAGCTTAACATCTGGTCCTCTCAAGTCTCCTTCAAGAGAGGGTAGCTGGGCATGGACCTCGGCTCCCCCACCCTCCATTTTCACACCTGGGATGCCGATCTTGGGCATGGAAAACTTGGGGAACTTAATTTTTGCTTCTGGACCTTGCAGATCTACATCTGGTCCTTCCAGTCCCACGCTGGGGACATCACCCTTTATCTTTGGTCCTTTCAAGTTTACATTCACATCAGGGATGGAGACTTGAGGGGCAGAAATGCCGAAGGACGGTGTTTTGACTTTAGCATCTAGGCCTTCGATGTTGATGTCAGGTGCACCCAAGTTTGCCTGCACTTTGGGGCCTTTCAGGTCACCCTCTATTTTTGGCACTGAGATGTCCACATCTGGCATCTTGACCTTGGGAGCCTTCGCCTTGATGTCAAGACCTTCGACGTGAATCGCTGGCAAAGAAAGTTCCAGATCAGGTGCCTGGAGTTCACCCTCCAGTTTGGGGCTAGGGAGAGGGGCCTCAGCTTTAAATTTAGGTGATTTAATGTCAAACTCTACATCTGGGAAGTACATTTTTCCAAACATCGTTTTCTTGGTTTTGGGCGATTTCACGTCGACTTTGAGTGCAGCATCCGGCCCTGCGATGTTGACATCTACATCCGGAGCCTTGAGGCTGGCATCAATTTCACCCCCAGGAACATTCAGGTCAAATCCCTGTTTTTTGGCCTTAATCTTAGGACCACTCATATGAATTTTAGGCATTTTAAACTTACTTTTCTTGCCCTTGCCACCAACACTAATTTCAGGAGTCTCAAGGTTCAGCTCTGCCTCAGGAACAGTGACATCCAGTGAAGGTGACTTGATGTCAGCTTTGGGGCTTTTTGCCCCAAATCCAAACTTGGGTTTCTTAAATTTGGGGATTTTAACATCTGGCCCTTCGATGTTAATATCTGGGCTGTCCATGTGTACATCTAAGCTTGGAGCTTCAACTTTGGGTCCCTTGAGGTCCACTTCACCACCTTCTAACTTCGGACCTGAAAATCCAATTTTTGGTGCCTTGAGATGCAAATCAACATCAGGAGCAGTTACTTTAGGAGCAGATATCTCCAGCGATGGCATCTTCAAAGATGGGCCACTGAGTTTGGCATCAGGGCCTTCGAAATCCAGACGTGGACCTTTAAGATCTACTTCTGGGCCTTTCAAAGTCCCTTCAACCTTAGGGACAGACACATCAAAATCTCCTTTTACTTTGGGTCCTTTCAAATCCAGGTCAACATCAGGTATGGAGATCTTGGGAGCTTTGATATTTATTTCAGGCATCTTGAACTTGGGGCCC