Transcript asmbl_22540

Sequence
Transcript Sequence for observation asmbl_22540 of TGE0056760:
CAGTTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTCTACCTCGCTAGCATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCGCGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTACGCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACCGCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATCCCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGCGTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAGACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCCCAGGAGTACTAAGAGGGCCCGCGCCGCGGCCGGCCGCCAGGCCTCCCCATGCCACCACAAAGGCCCTTTTAAGGGCCACCACCGCCCTCATGGAAAGAGCTGAGCCGCTTCAGACTGCGGGGCAAGCGGGCCGCGGCTCCCTTCCCCTCCCCTCCCCTCGCCCGCCTTCGCCGCCCGGCCTCGAGTCCCCGCCCGCCCCCGCTCCCGTCCCGCACCGCCTGCCGCGTCGGCCTCGGGCCCTGCCCTGTCCGCCGTCCGCCCTCCGGTAGGGTTCGGGCCTTCCGGATGCGGCTTGGGCGCTCTTCGGGGACCTCCGTGGCGCGGAAGACCCGAGCCTGCCGGGGGGAGGCCGGCGGCGCCGCACCTGCCCGCCTCGGCGTTCGTGACTCAGCCGCCCCATCCCGAGTCGCTAAGGGGCTGCGGGGAGGCCGCAGCACCTTCTGGAAGACTTGGCCTTCCGCTCTGACGCAGGGCCGAGGTGGGCAGTCCAGGCCGAGAGGCCGGCGGCCCTGAAGGTCTGCGCTGGGGCCGGGACGAAGCACTTGGTAACAGGCACATCTTCCTCCCGAGTGACTGCCTCCTAGGAGGACATTTAGGGGAGGGCAGAGGCCTGCAGTTTGGCTTCACGGCTGGCTATGTGGACAGCAAGAGTCGTTTTCGCGGAAGCCGACTGGCAGCCAGGCCTGTCGGGCCCCCCGACGCCGCCCCATTTCCCTTCCAGCAAACTCAACTCGGCAATCCAAGCACCTAGATACCAGCACAAGTCGGTTAATCCCTGTCTGGACTGAGCCTCCGTTGGCTTCTGAACTGGAATTCTGCAGCTAACCCTTCCACGACTAGAACCTTAGGCATTGGGGAGTTTTAGATGGACTAATTTTATTAAAGGATTGT