Transcript asmbl_21872

Sequence
Transcript Sequence for observation asmbl_21872 of TGE0059609:
GGAACCCTGCGCTCCAGCGGTGCGCGCCAGGAGAGGGGGCCCGAAGCGAGGTCTCGCCTAGAGTTGGAAAGGCAGCGTGCTTAGGGTTGTGACCGAGATTCCCGACGAGAGAGACTGAGGGGAAGAGAGGAAGGAGGGGCGGGCTCCTGGCAAGGCATTCGCTCCTGAGCGGAATCCTGCAAAGATGGAGAAGGAGGAGACAACCCGGGAGCTGCTGCTGCCCAACTGGCAGGGTAGTGGCTCCCACGGGCTGACCATCGCCCAGAGGGACGACGGCGTCTTTGTGCAGGAGGTGACGCAGAACTCCCCTGCGGCCCGCACTGGGGTGGTCAAGGAGGGGGACCAGATTGTGGGTGCCACCATCTACTTTGACAACCTGCAGTCGGGTGAGGTGACCCAGCTGCTGAACACCATGGGGCACCACACGGTGGGCCTGAAGCTGCACCGCAAGGGGGACCGCTCTCCCGAGCCTGGCCAGACCTGGACCCGTGAAGTCTTCAGCTCCTGCAGCTCTGAAGTGGTTCTGAGCGGGGATGATGAGGAGTACCAGCGCATCTACACCACGAAGATCAAGCCACGGCTGAAGTCGGAAGATGGAGTGGAAGGAGACCTCGGGGAGACCCAGAGCCGTACCATCACAGTGACCAGAAGGGTCACGGCCTACACTGTGGATGTGACTGGCCGGGAAGGAGCCAAGGACATAGACATCAGTAGCCCTGAATTCAAGATCAAGATTCCAAGACATGAACTGACTGAAATCTCCAATGTGGATGTGGAGACCCAGTCTGGGAAGACCGTGATCAGACTGCCCTCGGGCTCGGGGGCAGCCTCTCCGACAGGCTCTGCTGTGGATATCCGAGCAGGGGCCATTTCTGCTTCAGGACCAGAGCTCCAAGGTGCTGGCCACTCGAAGCTCCAGGTCACCATGCCTGGGATAAAGGTGGGAGGCTCAGGTGTCAATGTCAATGCAAAGGGCTTGGACTTGGGTGGCAGAGGAGGGGTCCAAGTTCCAGCAGTGGACATTTCATCTTCTCTTGGGGGTAGGGCAGTAGAGGTACAGGGCCCATCTCTGGAGAGTGGTGATCATGGCAAAATTAAATTTCCCACCATGAAAGTGCCGAAATTTGGTGTCTCAACAGGGCGTGAGGGCCAGACACCAAAGGCAGGGCTGAGGGTTTCTGCACCTGAAGTCTCTGTGGGGCACAAGGGCGGCAAGCCAGGCTTGACTATCCAAGCCCCTCAGCTGGAAGTCAGTGTGCCCTCTGCCAATATTGAGGGCCTTGAGGGGAAGCTGAAGGGCCCCCAAATCACTGGGCCATCACTTGAGGGTGACCTAGGCCTGAAAGGTGCCAAGCCACAGGGGCACATTGGGGTGGATGCCTCTGCTCCCCAAATTGGGGGTAGCATCACTGGCCCCAGTGTGGAAGTTCAGGCCCCTGACATTGATGTTCAGGGGCCTGGGAGCAAACTGAATGTGCCCAAGATGAAAGTCCCCAAGTTCTCTGTATCAGGTGCAAAGGGAGAGGAAACTGGGATTGATGTGACACTGCCTACAGGTGAAGTGACTGTTCCTGGGGTCTCTGGGGATGTCAGCCTGCCTGAGATTGCTACTGGTGGGCTGGAAGGAAAGATGAAAGGTACTAAAGTGAAGACTCCTGAAATGATTATTCAGAAACCTAAAATCTCCATGCAGGATGTGGATCTGAGCCTTGGGTCTCCTAAACTGAAAGGAGATATTAAGGTTTCTGCTCCTGGGGTGCAAGGTGATGTTAAAGGCCCTCAAGTGGCACTTAAAGGCTCCAGAGTGGACATAGAGACACCAAACCTAGAGGGAACCTTGACAGGCCCTAGGCTTGGCAGTCCTTCCGGGAAAACCGGAACCTGTAGGATCTCTATGTCAGAAGTAGACTTAAATGTGGCCGCACCTAAAGTGAAAGGGGGTGTAGATGTCACACTCCCCAGAGTAGAAGGGAAAGTCAAAGTCCCTGAAGTTGATGTCAGAGGCCCCAAAGTGGATGTCAGTGCCCCAGATGTCGAAGCGCATGGCCCAGAATGGA