Transcript asmbl_21871

Sequence
Transcript Sequence for observation asmbl_21871 of TGE0059609:
GCCTCCGCGCACGGGGGCCCGGCCACTCGGAGCTGCTCTGCCGCGGGGACTGCACCGCCCGCCCTGCCAGACCCGCCCGGAACGGGGCTCGTCGCCGCCAGTAGCCGCAGCACCGCAGCCTTGGGCCTCGCGCCGGCTATGGCCGTGCCCTGGGGCTGAGCCCTCAGGTTGTGACCGAGATTCCCGACGAGAGAGACTGAGGGGAAGAGAGGAAGGAGGGGCGGGCTCCTGGCAAGGCATTCGCTCCTGAGCGGAATCCTGCAAAGATGGAGAAGGAGGAGACAACCCGGGAGCTGCTGCTGCCCAACTGGCAGGGTAGTGGCTCCCACGGGCTGACCATCGCCCAGAGGGACGACGGCGTCTTTGTGCAGGAGGTGACGCAGAACTCCCCTGCGGCCCGCACTGGGGTGGTCAAGGAGGGGGACCAGATTGTGGGTGCCACCATCTACTTTGACAACCTGCAGTCGGGTGAGGTGACCCAGCTGCTGAACACCATGGGGCACCACACGGTGGGCCTGAAGCTGCACCGCAAGGGGGACCGCTCTCCCGAGCCTGGCCAGACCTGGACCCGTGAAGTCTTCAGCTCCTGCAGCTCTGAAGTGGTTCTGAGCGGGGATGATGAGGAGTACCAGCGCATCTACACCACGAAGATCAAGCCACGGCTGAAGTCGGAAGATGGAGTGGAAGGAGACCTCGGGGAGACCCAGAGCCGTACCATCACAGTGACCAGAAGGGTCACGGCCTACACTGTGGATGTGACTGGCCGGGAAGGAGCCAAGGACATAGACATCAGTAGCCCTGAATTCAAGATCAAGATTCCAAGACATGAACTGACTGAAATCTCCAATGTGGATGTGGAGACCCAGTCTGGGAAGACCGTGATCAGACTGCCCTCGGGCTCGGGGGCAGCCTCTCCGACAGGCTCTGCTGTGGATATCCGAGCAGGGGCCATTTCTGCTTCAGGACCAGAGCTCCAAGGTGCTGGCCACTCGAAGCTCCAGGTCACCATGCCTGGGATAAAGGTGGGAGGCTCAGGTGTCAATGTCAATGCAAAGGGCTTGGACTTGGGTGGCAGAGGAGGGGTCCAAGTTCCAGCAGTGGACATTTCATCTTCTCTTGGGGGTAGGGCAGTAGAGGTACAGGGCCCATCTCTGGAGAGTGGTGATCATGGCAAAATTAAATTTCCCACCATGAAAGTGCCGAAATTTGGTGTCTCAACAGGGCGTGAGGGCCAGACACCAAAGGCAGGGCTGAGGGTTTCTGCACCTGAAGTCTCTGTGGGGCACAAGGGCGGCAAGCCAGGCTTGACTATCCAAGCCCCTCAGCTGGAAGTCAGTGTGCCCTCTGCCAATATTGAGGGCCTTGAGGGGAAGCTGAAGGGCCCCCAAATCACTGGGCCATCACTTGAGGGTGACCTAGGCCTGAAAGGTGCCAAGCCACAGGGGCACATTGGGGTGGATGCCTCTGCTCCCCAAATTGGGGGTAGCATCACTGGCCCCAGTGTGGAAGTTCAGGCCCCTGACATTGATGTTCAGGGGCCTGGGAGCAAACTGAATGTGCCCAAGATGAAAGTCCCCAAGTTCTCTGTATCAGGTGCAAAGGGAGAGGAAACTGGGATTGATGTGACACTGCCTACAGGTGAAGTGACTGTTCCTGGGGTCTCTGGGGATGTCAGCCTGCCTGAGATTGCTACTGGTGGGCTGGAAGGAAAGATGAAAGGTACTAAAGTGAAGACTCCTGAAATGATTATTCAGAAACCTAAAATCTCCATGCAGGATGTGGATCTGAGCCTTGGGTCTCCTAAACTGAAAGGAGATATTAAGGTTTCTGCTCCTGGGGTGCAAGGTGATGTTAAAGGCCCTCAAGTGGCACTTAAAGGCTCCAGAGTGGACATAGAGACACCAAACCTAGAGGGAACCTTGACAGGCCCTAGGCTTGGCAGTCCTTCCGGGAAAACCGGAACCTGTAGGATCTCTATGTCAGAAGTAGACTTAAATGTGGCCGCACCTAAAGTGAAAGGGGGTGTAGATGTCACACTCCCCAGAGTAGAAGGGAAAGTCAAAGTCCCTGAAGTTGATGTCAGAGGCCCCAAAGTGGATGTCAGTGCCCCAGATGTCGAAGCGCATGGCCCAGAATGGA