Transcript asmbl_21836

Sequence
Transcript Sequence for observation asmbl_21836 of TGE0003424:
CTGGGAAAGGGCAATTTCCGTTAGGTGCTGAAGGCTGTGGCGCGCGGCTGTCCCCATTCCCACGTGAAGCGCTACGCTAGCATCGCTCGGCTGGCGGCTCCCAGCTCGCCGCGGAGCAGTCCCGGCAGCAGCGGGGGACCGGAAGTGGCTCGCGGAGGCTCAGAAGCTAGTCCCGGAGCCCGGCGTGTGGCGCCTCGGAGCACGGTGACGGCGCCATGTCCCTAATCTGCTCCATCTCTAACGAAGTGCCGGAGCACCCATGTGTATCCCCTGTCTCTAATCATGTTTATGAGCGGCGGCTCATCGAGAAGTACATTGCGGAGAATGGTACCGACCCCATCAACAACCAGCCTCTCTCCGAGGAGCAGCTCATCGACATCAAAGTTGCTCACCCAATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCTTTGCAGGATGAGTGGGATGCAGTCATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGCCAAGAGCTGTCACACGCTCTGTACCAGCACGATGCCGCCTGCCGTGTCATTGCCCGTCTCACCAAGGAAGTCACTGCTGCCCGAGAAGCTCTGGCTACCCTGAAACCACAGGCTGGCCTCATTGTGCCCCAGGCTGTGCCAAGTTCCCAACCAAGTGTTGTGGGTGCGGGTGAGCCAATGGATTTGGGTGAGCTGGTGGGAATGACCCCAGAGATTATTCAGAAGCTTCAAGACAAAGCCACTGTGCTAACCACGGAGCGCAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAGCCAGAAGAGCTCAGCAAATACCGGCAGGTGGCATCCCACGTGGGGTTGCACAGTGCCAGCATTCCTGGGATCCTGGCCCTGGACCTCTGCCCGTCCGACACCAACAAGATCCTCACTGGTGGGGCGGATAAAAATGTCGTTGTGTTTGACAAAAGTTCTGAACAAATCCTGGCTACCCTCAAAGGCCATACCAAGAAGGTCACCAGCGTGGTGTTTCACCCTTCCCAGGACCTGGTGTTTTCTGCTTCCCCCGATGCCACTATCAGGATTTGGTCGGTCCCCAATGCCTCTTGTGTACAGGTGGTTCGGGCCCATGAGAGTGCTGTGACAGGCCTCAGCCTTCATGCCACTGGCGACTATCTCCTGAGCTCCTCCGATGATCAGTACTGGGCTTTCTCTGACATCCAGACAGGGCGTGTGCTCACCAAGGTGACAGATGAGACCTCCGGCTGCTCTCTCACCTGTGCACAGTTCCACCCTGACGGACTCATCTTTGGAACAGGAACCATGGACTCTCAGATCAAGATCTGGGACTTGAAGGAACGTACTAATGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACTAGCATCGCCTTCTCTGAGAATGGTTACTACCTGGCTACAGCGGCTGATGACTCCTCTGTCAAGCTCTGGGATCTGCGCAAGCTTAAGAACTTTAAGACTTTGCAGCTGGATAACAACTTTGAGGTAAAGTCACTGATCTTTGACCAGAGTGGTACCTACCTGGCTCTTGGGGGCACGGATGTCCAGATCTACATCTGCAAACAATGGACGGAGATTCTTCACTTTACAGAGCATAGCGGCCTGACCACAGGGGTGGCCTTCGGGCATCACGCCAAGTTCATCGCTTCAACAGGCATGGACAGAAGCCTCAAGTTCTACAGCCTGTAGGCCCTGGCCCTTCTGATGGAAGCTGGGCCTCATCTCAGTAGAGGGGTAGAATTAGGGTTTGG