Transcript asmbl_21472

Sequence
Transcript Sequence for observation asmbl_21472 of TGE0057122:
CCGGTCCGGGTGCAAACACGCGGGTCAGCTGATCCGGCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCCGGCCGCCGCCGCCATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCGCTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGGGGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCAGCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAGCCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCCTACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCCAGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTCATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTGATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTGAAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAGGCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGGCCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGACAACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAGTTCCCAAGGCGTCCGCGCGCCAGCACAGAAACAGAGGAGAGTCCCAGAGCAGGAGGCCCCTGGCCCAGCGGCCCCTCCCACACACACCCACACACTCGCCCGCCCACTGTCCTGGGCGCCCTGGAAGCCGGCGGCCCAAGCCCGACTTGCTGTTTTGTTCTGTGGTTTTCCCCTCCCTGGGTTCAGAAATGCTGCCTGCCTGTCTGTCTCTCCATCTGTTTGGTGGGGGTAGAGCTGATCCAGAGCACAGATCTGTTTCGTGCATTGGAAGACCCCACCCAAGCTTGGCAGCCGAGCTCGTGTATCCTGGGGCTCCCTTCATCTCCAGGGAGTCCCCTCCCCGGCCCTACCAGCGCCCGCTGGGCTGAGCCCCTACCCCACACCAGGCCGTCCTCCCGGGCCCTCCCTTGGAAACCTGCCCTGCCTGAGGGCCCCTCTGCCCAGCTTGGGCCCAGCTGGGCTCTGCCACCCTACCTGTTCAGTGTCCCGGGCCCGTTGAGGATGAGGCCGCTAGAGGCCTGAGGATGAGCTGGAAGGAGTGAGAGGGGACAAAACCCACCTTGTTGGAGCCTGCAGGGTGGTGCTGGGACTGAGCCAGTCCCAGGGGCATGTATTGGCCTGGAGGTGGGGTTGGGATTGGGGGCTGGTGCCAGCCTTCCTCTGCAGCTGACCTCTGTTGTCCTCCCCTTGGGCGGCTGAGAGCCCCAGCTGACATGGAAATACAGTTGTTGGCCTCCGGCCTCCCCT