Transcript asmbl_16531

Sequence
Transcript Sequence for observation asmbl_16531 of TGE0003336:
GGGCTGTGTTACGAGCTTTGCTTCTTTAGTCTGCACCGGATAGCAGAGGAGTCTGGTGGCACTTGGGAAATGTTATAATCTGCATGACTGCAAATGACTCAAAGCTTTGCTCAACTTTTTGAAGGGCTAGGGGGCCTTGGCAGCTTTCCATTTAGATGTTTTCTGGAGACTGACTGTTGGCAGCTGAAGGAGCCCCAGGGTTTCTGGGTGGCCTGGTCCTGCCTATGGAGTGACTGAGCCTAGGGACCTAGTCCCGCCTCCAGCCCTCCCCTTGCCGCCTGCCCAGGCCCGTCTGCTCACCCCTGGATATACTTCTTTGTCAAGAGAAGCAGAGGTGTGGACGCTGTGTATGAAATGTCTTTCCTCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGATTGTGTGAAACTGCCCAGCTCAGGGATAACCAGGGACATTCACCTGTGTTCATGGGATGTATTGTTTCCACTCGTGTCCCTAAGGAGTGAGAAACCCATTTATACTCTACTCTCAGTATGGATTATTAATGTATTTTAATATTCTGTTTAGGCCCACTAAGGCAAAATAGCCCCAAAACAAGACTGACAAAAATCTGAAAAACTAATGAGGATTATTAAGCTAAAACCTGGGAAATAGGAGGCTTAAAATTGACTGCCAGGCTGGGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGAGCAAGTCACTTGAGGTCGGGAGTTCGAGACCAGCCTGAGCAACATGG