Transcript asmbl_16495

Sequence
Transcript Sequence for observation asmbl_16495 of TGE0056755:
GTAGGAGTGGCGGCCCAGGTCTGAGCTGCGCTGCCATTGGGCGCGGCGACGAGAGGGGGCGGGGAGCCCGTGAGGCTGGTTACGCCGAGGGAAGCCCCGACTCCGTAGTCGCTGCACAGTCTGTCTCTTCGCCGGTTCCCGGCCCCGTGGATCCTACTTCTCTGTCGCCCGCGGTTCGCCGCCCCGCTCGCCGCCGCGATGCCAGTGTTTCATACGCGCACGATCGAGAGCATCCTGGAGCCGGTGGCACAGCAGATCTCCCACCTGGTGATAATGCACGAGGAGGGCGAGGTGGACGGCAAAGCCATTCCTGACCTCACCGCGCCCGTGGCCGCCGTGCAGGCGGCCGTCAGCAACCTCGTCCGGGTTGGAAAAGAGACTGTTCAAACCACTGAGGATCAGATTTTGAAGAGAGATATGCCACCAGCATTTATTAAGGTTGAGAATGCTTGCACCAAGCTTGTCCAGGCAGCTCAGATGCTTCAGTCAGACCCTTACTCAGTGCCTGCTCGAGATTATCTAATTGATGGGTCAAGGGGCATCCTCTCTGGAACATCAGACCTGCTCCTTACCTTCGATGAGGCTGAGGTCCGTAAAATTATTAGAGTTTGCAAAGGAATTTTGGAATATCTTACAGTGGCAGAGGTGGTGGAGACTATGGAAGATTTGGTCACTTACACAAAGAATCTTGGGCCAGGAATGACTAAGATGGCCAAGATGATTGACGAGAGACAGCAGGAGCTCACTCACCAGGAGCACCGAGTGATGTTGGTGAACTCGATGAACACCGTGAAAGAGTTGCTGCCAGTTCTCATTTCAGCTATGAAGATTTTTGTAACAACTAAAAACTCAAAAAACCAAGGCATAGAGGAAGCTTTAAAAAATCGCAATTTTACTGTAGAAAAAATGAGTGCTGAAATTAATGAGATAATTCGTGTGTTACAACTCACCTCTTGGGATGAAGATGCCTGGGCCAGCAAGGACACTGAAGCCATGAAGAGAGCATTGGCCTCCATAGACTCCAAACTGAACCAGGCCAAAGGTTGGCTCCGTGACCCTAGTGCCTCCCCAGGGGATGCTGGTGAGCAGGCCATCAGACAGATCTTAGATGAAGCTGGAAAAGTTGGTGAACTCTGTGCAGGCAAAGAACGCAGGGAGATTCTGGGAACTTGCAAAATGCTAGGGCAGATGACTGATCAAGTGGCTGACCTCCGTGCCAGAGGACAAGGATCCTCACCGGTGGCCATGCAGAAAGCTCAGCAGGTATCTCAGGGTCTGGATGTGCTCACAGCAAAAGTGGAAAATGCAGCTCGCAAGCTGGAAGCCATGACCAACTCAAAGCAGAGCATTGCAAAGAAGATCGATGCTGCTCAGAACTGGCTTGCAGATCCAAATGGTGGACCGGAAGGAGAAGAGCAGATTCGAGGTGCTTTGGCTGAAGCTCGGAAAATAGCAGAATTATGTGATGATCCTAAAGAAAGAGATGACATTCTACGTTCCCTTGGGGAAATATCTGCTCTGACTTCTAAATTAGCAGATCTACGAAGACAGGGGAAAGGAGATTCTCCAGAGGCTCGAGCCTTGGCCAAACAGGTGGCCACGGCCCTGCAGAACCTGCAGACCAAAACCAACCGGGCTGTGGCCAACAGCAGACCGGCCAAAGCAGCTGTACACCTTGAGGGCAAGATTGAGCAAGCACAGCGGTGGATTGATAATCCCACAGTGGATGACCGTGGAGTCGGTCAGGCTGCCATCCGGGGGCTTGTGGCCGAAGGGCATCGTCTGGCTAATGTTATGATGGGGCCTTATCGGCAAGATCTTCTCGCCAAGTGTGACCGAGTGGACCAGCTGACAGCCCAGCTGGCTGACCTGGCTGCCAGAGGGGAAGGGGAGAGTCCTCAGGCACGAGCACTTGCATCTCAGCTCCAAGACTCCTTAAAGGATCTAAAAGCTCGGATGCAGGAGGCCATGACTCAGGAAGTGTCAGATGTTTTCAGCGATACCACAACTCCCATCAAGCTGTTGGCAGTGGCAGCCACGGCGCCTCCTGATGCGCCTAACAGGGAAGAGGTATTTGATGAGAGGGCAGCTAACTTTGAAAACCATTCAGGAAAGCTTGGTGCTACGGCCGAGAAGGCGGCTGCGGTTGGTACTGCTAATAAATCAACAGTGGAAGGCATTCAGGCCTCAGTGAAGACGGCCCGAGAACTCACACCCCAGGTGGTCTCGGCTGCTCGTATCTTACTTAGGAACCCTGGAAATCAAGCTGCTTATGAACATTTTGAGACCATGAAGAACCAGTGGATCGATAATGTTGAAAAAATGACAGGGCTGGTGGACGAAGCCATTGATACCAAATCTCTGTTGGATGCTTCAGAAGAAGCAATTAAAAAAGACCTGGACAAGTGCAAGGTAGCTATGGCCAACATTCAGCCTCAGATGCTGGTTGCTGGGGCAACCAGTATTGCTCGTCGGGCCAACCGGATCCTGCTGGTGGCTAAGAGGGAGGTGGAGAATTCCGAGGATCCCAAGTTCCGTGAGGCTGTGAAAGCTGCCTCTGATGAATTGAGCAAAACCATCTCCCCGATGGTGATGGATGCAAAAGCTGTGGCTGGAAACATTTCCGACCCTGGACTGCAAAAGAGCTTCCTGGACTCAGGATATCGGATCCTGGGAGCTGTGGCCAAGGTCAGAGAAGCCTTCCAACCTCAGGAGCCTGACTTCCCGCCGCCTCCACCAGACCTTGAACAACTCCGACTAACAGATGAGCTTGCTCCTCCCAAACCACCTCTGCCTGAAGGTGAGGTCCCTCCACCTAGGCCTCCACCACCAGAGGAAAAGGATGAAGAGTTCCCTGAGCAGAAGGCCGGGGAGGTGATTAACCAGCCAATGATGATGGCTGCCAGACAGCTCCATGATGAAGCTCGCAAATGGTCCAGCAAGGGCAATGACATCATTGCAGCAGCCAAGCGCATGGCTCTGCTGATGGCTGAGATGTCTCGGCTGGTAAGAGGGGGCAGTGGTACCAAGCGGGCACTCATTCAGTGTGCCAAGGACATCGCCAAGGCCTCAGATGAGGTGACTCGGTTGGCCAAGGAGGTTGCCAAGCAGTGCACAGATAAACGGATTAGAACCAACCTCTTACAGGTATGTGAGCGAATCCCAACCATAAGCACCCAGCTCAAAATCCTGTCCACAGTGAAGGCCACCATGCTGGGCCGGACCAACATCAGTGATGAGGAGTCTGAGCAGGCCACAGAGATGCTGGTTCACAATGCCCAGAACCTCATGCAGTCTGTGAAGGAGACTGTGCGGGAAGCTGAAGCTGCTTCAATCAAAATTCGAACAGATGCTGGATTTACACTGCGCTGGGTTAGAAAGACTCCCTGGTACCAGTAGGCACCTGGCTGAGCCTGGCTGGCACAGAAACCTCTACTAAAAAGAAGGAAAATGATCTGAGTCCCAGGAGCTGCCCAGAGTTGCTGGGAGCTGAAAAATCACATCCTGGCCTGGCACATCAGAAAGGAATGGGGGCCTCTTCAAATTAGAAGACATTTATACTCTTTTTTCATGGACACTTTGAAATGTGTTTCTGTATAAAGCCTGTATTCTCAAACACAGTTACACTTGTGCACCCTCTATCCCAATAGGCAGACTGGGTTTCTAGCCCATGGACTTCACATAAGCTCAGAATCCAAGTGAACACTAGCCAGACACTCTGCTCTGCCCTTGTTCCCTAGGGGACACTTCCCTCTGTTTCTCTTTCCTTGGCTCCCATTCACTCTTCCAGAATCCCAAGACCCAGGGCCCAGGCAAATCAGTTACTAAGAAGAAAATTGCTGTGCCTCCCAAAATTGTTTTGAGCTTTCCATGTTGCTGCCAACCATACCTTCCTTCCCTGGGCTGTGCTACCTGGGTCCTTTTCAGAAGTGAGCTTTGCTGCTACAGGGGAAGGTGGCCTCTGTGGAGCCCCAGCATATGGGGGCCTGGATTCATTTCCTGCCCTTCCTCAGTTTAATCCTTCTAGTTTCCCACAATATAAAACTGTACTTCACTGTCAGGAAGAAATCACAGAATCATATGATTCTGCTTTTACCATGCCCCTGAGCAATGTCTGTGCTAGGGAAACTTCCCGTCCCATATCCTGCCTCAGCCCGCCAAGGTAGCCATCCCATGAACACACTGTGTCCTGGTGCTCTCTGCCACTGGAAGGGCAGAGTAGCCAGGGTGTGGCCCTGCCATCTTCCCAGCAGGGCCACTCCCGGCACTCCATGCTTAGTCACTGCCTGCAGAGGTCTGTGCTGAGGCCTTATCATTCATTCTTAGCTCTTAATTGTTCATTTTGAGCTGAAATGCTGCATTTTAATTTTAACCAAAACATGTCTCCTATCCTGGTTTTTGTAGCCTTCCTCCACATCCTTTCTAAACAAGATTTTAAAGACATGTAGGTGTTTGTTCATCTGTAACTCTAAAAGATCCTTTTTAAATTCAGTCCTAAGAAAGAGGAGTGCTTGTCCCCTAAGAGTGTTTAATGGCAAGGCAGCCCTGTCTGAAGGACACTTCCTGCCTAAGGGAGAGTGGTATTTGCAGACTAGAATTCTAGTGCTGCTGAAGATGAATCAATGGGAAATACTACTCCTGTAATTCCTACCTCCCTGCAACCAACTACAACCAAGCTCTCTGCATCTACTCCCAAGTATGGGGTTCAAGAGAGTAATGGGTTTCATATTTCTTATCACCACAGTAAGTTCCTACTAGGCAAAATGAGAGGGCAGTGTTTCCTTTTTGGTACTTATTACTGCTAAGTATTTCCCAGCACATGAAACCTTATTTTTTCCCAAAGCCAGAACCAGATGAGTAAAGGAGTAAGAACCTTGCCTGAACATCCTTCCTTCCCACCCATCGCTGTGTGTTAGTTCCCAACATCGAATGTGTACAACTTAAGTTGGTCCTTTACACTCAGGCTTTCACTATTTCCTTTATAATGAGGATGATTATTTTCAAGGCCCTCAGCATATTTGTATAGTTGCTTGCCTGATATAAATGCAATATTAATGCCTTTAAAGTATGAATCTATGCCAAAGATCACTTGTTGTTTTACTAAAGAAAGATTACTTAGAGGAAATAAGAAAAATCATGTTTGCTCTCCCGGTTCTTCCAGTGGTTTGAGACACTGGTTTACACTTTATGCCGGATGTGCTTTTCTCCAATATCAGTGCTCGAGACACAGTGAAGCAAATT