Transcript asmbl_16174

Sequence
Transcript Sequence for observation asmbl_16174 of TGE0056140:
GTCCTCTGCCACTCTCGCTCCGAGGTCCCCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACACCCACCGCGCCCTCGTTCGCCTCTTCTCCGGGAGCCAGTCCGCGCCACCGCCGCCGCCCAGGCCATCGCCACCCTCCGCAGCCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCACCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCCTGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGGGCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCGAGGACATCATGCGCCTCCGGGAGAAATTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAAAACACCCTGCAATCTTTCAGACAGGATGTTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCGTGAGTACCAACCCTGCAGTAAAAGAGGGAAAATAATGACCCATTCTGCTGACTAGGCTCATGATGATACCTGAACAAAATGTTGAGTGAGTAAAAATGTATATCATAATGCAAAGAAAATGAGTTATCAAGACAGACTCAAAAGGGACTTCATGGAACTCTTGAAGGTTTTAGCTTGCCTATATCATTGCTTCTAATATGAAGGACTTGGTACTCGCATTCTCCACCTAAAATTAGAGTGGTCGCCATTTGCCGCTAATGGAAATTATTGCAGAAGGTCTGTAAATGGTTCTGGGAACAGCTGGGTTTTTCTGAGAAATAACACCAGACATCTTTCTCACCCCCTGCAGAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGTAGGGAACTCAGACTTGGATGCGTGAACTAATGGTGACCATTTGTTAGGCCCTGTGCCACTGGGCTCTAAGCAGTGTCACATTTAATCTTTAGAAAGTTTCTTTGAGGTAACTGCTTTCCACTTTTTGTAGAGGAGGAATTTGAATTGAGAGAGAGTAAGTGACTTGCTGAAAAAGGGTTAATCAACAGCAGAGCTGGGATTTGAACCCATAACTCTGTCAAAGCCTCCACTCCTAACTCCTGTTCATGCTCCTGTGGAGAAAATGCTTGTAGTAACATATTTTAAATGTACTAACAAGACCAGTCATGGGAAAATGTTTCTGAGACAAATCTCTAGTTTATGATTTAAAACAGTACGTTTTCTTACGTGACGAAAACAAAAAGTGTGTTAATTTGTTCCCAGTGGTTGAAGTTATTTGCCAACAATTTTACTGTTTCTCTTCATCTGTTTATAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCCCTGAACCTGAGGGGTAAGCATTTTATTTCCCTTTAGGAAAAACGTCAGCTGCTTGTAACCACTGTGTTTATGTCAAAGCATTCATTTTTTTTAGGATATCTGAAAAAATGCCATATAAGAGAAAACTCTATAAAACATCTATAATTTTCGAACCCAAGTACACTCTTGCATTCTATGCTTTAAGTTAAATGCAAACTCCTTTTTCCTTCTTCCTGCTGCAAGTACTATCTCATCCTGATGCTCAAGAGTGTCAGGGCCTGGGTTTCCAAACAGAGACTACCCTAAAATTATTTGGCGAGTAGTACTTTACACAATTGCCTCTCCCCCACAAATCATAATTGTTTCAGTAAAATGGTTACTTGGTTTTTCCAAGAAAAAACTCGTTTTTACTCATTTTTGGCCTGTTTGTTTATTTAGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAGCATCACGATGACCTTGAATAAAAATTGCACACACTCAGTGCAGCAATATATTACCAGCAAGAATAAAAAAGAAATCCATATCTTAAAGAAACAGCTTTCAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGGAATAGGAATAAGCTCTAGTTCTTAACAACCGACACTCCTACAAGATTTAGAAAAAAGTTTACAACATAATCTAGTTTACAGAAAAATCTTGTGCTAGAATACTTTTTAAAAGGTATTTTGAATACCATTAAAACTGCTTTTTTTTTTCCAGCAAGTATCCAACCAACTTGGTTCTGCTTCAATAAATCTTTGGAAAAACTC