Transcript asmbl_15652

Sequence
Transcript Sequence for observation asmbl_15652 of TGE0056901:
TCTTAAAGAGAGAATTCCCGGAAGGGAGACAAGGCAGTTTCTTTTTCTGTGTGACAATAAAAAACGGTAAACAAGCCTCCAGAAGCTCATTCAGCCCCCATATAACTTTTTCGAGAAAGAAAAGGTGCCGTTCTTCCGAGCCCTCCGGCTTAACCACTGCTTCGGTGCTGACTTATTTCCTACGTCTGAGAACTGCCAGAAAATGAGCAATATCTGTTCTGAAGGCTGCAGGCTCTCTCCCCGCCCCCGCGGGGCGGCGCGCACTCACCCACCCGCGCCGGAGCGGACCTTTGGCTTGGCTTGTCAGGGCTTGTCCAGGAGTTCCGCTCCTCTCTCCAACCGGGGTCCCCCTCCAGCGACCCTAAAGCTTCCCAGACTTCCGCTTCAATTCCTGTCCGCACCCCACGCCCACCTCAACGTGGAGCGCAGTGGTCTCCGAGGAGCGCCGGAGCTGCCCCGCCTGCCCAGCGGGGTCAGCACTTCGCATCAAGGCCCAAGAAAAGCAAGTCCTCCAGCGTTCTGAGCACCCGGGCCTGAGGGAAGGTCCTAACAGCCCCCGGGAGCCAGTCTCCAACGCCTCCCGCAGCAGCCCGCCGCTCCCAGAATCCTGTGAAGCAGCTCCAGCTATGTGTGAAGAAGAGGACAGCACTGCCTTGGTGTGTGACAATGGCTCTGGGCTCTGTAAGGCCGGCTTTGCTGGGGACGATGCTCCCAGGGCTGTTTTCCCATCCATTGTGGGACGTCCCAGACATCAGGGGGTGATGGTGGGAATGGGACAAAAAGACAGCTACGTGGGTGACGAAGCACAGAGCAAAAGAGGAATCCTGACCCTGAAGTACCCGATAGAACATGGCATCATCACCAACTGGGACGACATGGAAAAGATCTGGCACCACTCTTTCTACAATGAGCTTCGTGTTGCCCCTGAAGAGCATCCCACCCTGCTCACGGAGGCACCCCTGAACCCCAAGGCCAACCGGGAGAAAATGACTCAAATTATGTTTGAGACTTTCAATGTCCCAGCCATGTATGTGGCTATCCAGGCGGTGCTGTCTCTCTATGCCTCTGGACGCACAACTGGCATCGTGCTGGACTCTGGAGATGGTGTCACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCCGACCGAATGCAGAAGGAGATCACGGCCCTAGCACCCAGCACCATGAAGATCAAGATCATTGCCCCTCCGGAGCGCAAATACTCTGTCTGGATCGGTGGCTCCATCCTGGCCTCTCTGTCCACCTTCCAGCAGATGTGGATCAGCAAACAGGAATACGATGAAGCCGGGCCTTCCATTGTCCACCGCAAATGCTTCTAAAACACTTTCCTGCTCCTCTCTGTCTCTAGCACACAACTGTGAATGTCCTGTGGAATTATGCCTTCAGTTCTTTTCCAAATCATTCCTAGCCAAAGCTCTGACTCGTTACCTATGTGTTTTTTAATAAATCTGAAATAGGCTACTGGTAA