Transcript asmbl_15373

Sequence
Transcript Sequence for observation asmbl_15373 of TGE0003252:
TTCCTCCTCGGCTGCGCCGCGTGTCCTCGGAGCGCGGTCCCTGTATTGGTCTCCTGCTCCTAGAGGTTGAGAACAAAAACATGCACCTGGAGTTTCCCCGGAGCCCTCTGCGTGGTTGAGCTTCGGTGGAATTTCGGGGCTCTTGGCTGCCAGCCGCGCTTGCCTGGTAGCAACAGAAACCAGTCCTGCTCGCCTCCGTGGACATTTCATTACCATCCAGAAGTGTCTCCCACTGAAGGCATCCGTGGTTGTTTTTAAGCCACAAAAAAGCCACACCCAAGATCACCTGACACCCACCCTGACAAGTGTCCATGATGCTGGGCCCTGAGGGAGGTGAAGGCTTTGTGGTCAAGCTCCGTGGCCTGCCCTGGTCCTGCTCTGTTGAGGACGTGCAGAACTTCCTCTCTGACTGCACGATTCATGATGGGGCCGCAGGTGTCCATTTCATCTACACTAGAGAGGGCAGGCAGAGTGGTGAGGCTTTTGTTGAACTTGGATCAGAAGATGATGTAAAAATGGCCCTGAAAAAAGACAGGGAAAGCATGGGACACCGGTACATTGAGGTGTTCAAGTCCCACAGAACCGAGATGGATTGGGTGTTGAAGCACAGTGGTCCCAACAGTGCCGACAGCGCCAACGATGGCTTCGTGCGGCTTCGAGGACTCCCATTTGGATGCACAAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATTGTGCCAAACGGGATCACATTGCCTGTGGACCCCGAAGGCAAGATTACAGGGGAAGCGTTCGTGCAGTTTGCCTCGCAGGAGTTAGCTGAGAAGGCTCTAGGGAAACACAAGGAGAGGATAGGGCACAGGTACATTGAGGTGTTTAAGAGCAGCCAGGAGGAAGTTAGGTCATACTCAGATCCCCCTCTGAAGTTCATGTCCGTGCAGCGGCCAGGGCCCTATGACCGGCCCGGGACTGCCAGGAGGTACATTGGCATCGTGAAGCAGGCAGGCCTGGAAAGGATGAGGCCTGGTGCCTACAGCACAGGCTACGGGGGCTACGAGGAGTACAGTGGCCTCAGTGATGGCTACGGCTTCACCACCGACCTGTTCGGGAGAGACCTCAGCTACTGTCTCTCCGGAATGTATGACCACAGATACGGCGACAGTGAGTTCACAGTGCAGAGCACCACAGGCCACTGTGTCCACATGAGGGGCCTGCCGTACAAAGCGACCGAGAACGACATTTACAACTTCTTCTCTCCTCTCAACCCTGTGAGAGTCCATATTGAGATTGGCCCAGATGGAAGAGTGACGGGTGAAGCAGATGTTGAGTTTGCTACTCATGAAGAAGCTGTGGCAGCTATGTCCAAAGACAGGGCCAATATGCAGCACAGATATATAGAACTCTTCTTGAATTCAACAACAGGGGCCAGCAATGGGGCGTATAGCAGCCAGGTGATGCAAGGCATGGGGGTGTCTGCTGCCCAGGCCACTTACAGTGGCCTGGAGAGCCAGTCAGTGAGTGGCTGTTACGGGGCCGGCTACAGTGGGCAGAACAGCATGGGTGGCTATGACTAGTTTTGTTAGGAACATTTGAGTTACTTCAATCATTTTCACAGGCAGCCAACAAGCAATTAAGAGCAGTTATAATAGAGGAAGCTGGGGGACCCATTTTGCACCATGAGTTTGTGAAAAATCTGGATTAAAAAATTACCTCTTCAGTGTTTTCTCATGCAAAATTTTCTTCTAGCATGTGATAATGAGTAAACTAAAACTATTTTCAGCTTTTCTCAATTAACATTTTGGTAGTATACTTCAGAGTGATGTTATCTAAGTTTAAGTAGTTTAAGTATGTTAAATGTGGATCTTTTACACCACATCACAGTGAACACACTGGGGAGACGTGCTTTTTTGGAAAACTCAAAGGTGCTAGCTCCCTGATTCAAAGAAATATTTCTCATGTTTGTTCATTCTAGTTTATATTTTCATTTAAAATCCTTTAGGTTAAGTTTAAGCTTTTTAAAAGTTAGTTTTGAGAATTGAGACACAATACTAATACTGTAGGAATTGGTGAGGCCTTGACTTAAAACTTTCTTTGTACTGTGATTTCCTTTTGGGTGTATTTTGCTAAGTGAAACTTGTTAAATTTTTTGTTAACTAAATTTTTTTCTTAAAATAAAGACTTTTTCACAATGACTGGCACAGATTACTCAGCAAAAGATAGCAAAACGGGTGGTTGAAGATAATTCATTTTAATCGTAATGTATTTTAGTGTGAATTTAAAAATTTCATACATCAAATCTATGATCTCCCTTATATTCTTATGATGAGGCTAAATAAAAGTCTAATAAAAATGTTAAATATGTGAATGGTGGAAATGGTGACTAGCAGCACACATTCTGGGAAGCATCAAATAGACACACGGCCCCAGCCACCTGCAACTTATGTGCACTGTTGTAAACCATTCAGAATTTTCCTGCTAGGCCCTTGATGCTGGAGTCACATCTGTTGATAGCTGGAGAACTTTAGTTTCAAGTACTACATTGTGAAAGCAATTATTTTGTTTCTAGTTTTTATAAAATGCTG