Transcript asmbl_15372

Sequence
Transcript Sequence for observation asmbl_15372 of TGE0003252:
CTTGGCGGGCCCGGCAATGGCACTTCCTCCTCTGCACCCCGTGACCCACGTCCGGCTGCCGGTCTTGGATCACGAGGCCTCCGCTTCCCGGACTCCGGACCCCGCGCCTCCTCGGGGCCGACGGGCCAGTCCCTGGCGTGGTTGAGAACAAAAACATGCACCTGGAGTTTCCCCGGAGCCCTCTGCGTGGTTGAGCTTCGGTGGAATTTCGGGGCTCTTGGCTGCCAGCCGCGCTTGCCTGGTAGCAACAGAAACCAGTCCTGCTCGCCTCCGTGGACATTTCATTACCATCCAGAAGTGTCTCCCACTGAAGGCATCCGTGGTTGTTTTTAAGCCACAAAAAAGCCACACCCAAGATCACCTGACACCCACCCTGACAAGTGTCCATGATGCTGGGCCCTGAGGGAGGTGAAGGCTTTGTGGTCAAGCTCCGTGGCCTGCCCTGGTCCTGCTCTGTTGAGGACGTGCAGAACTTCCTCTCTGACTGCACGATTCATGATGGGGCCGCAGGTGTCCATTTCATCTACACTAGAGAGGGCAGGCAGAGTGGTGAGGCTTTTGTTGAACTTGGATCAGAAGATGATGTAAAAATGGCCCTGAAAAAAGACAGGGAAAGCATGGGACACCGGTACATTGAGGTGTTCAAGTCCCACAGAACCGAGATGGATTGGGTGTTGAAGCACAGTGGTCCCAACAGTGCCGACAGCGCCAACGATGGCTTCGTGCGGCTTCGAGGACTCCCATTTGGATGCACAAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATTGTGCCAAACGGGATCACATTGCCTGTGGACCCCGAAGGCAAGATTACAGGGGAAGCGTTCGTGCAGTTTGCCTCGCAGGAGTTAGCTGAGAAGGCTCTAGGGAAACACAAGGAGAGGATAGGGCACAGGTACATTGAGGTGTTTAAGAGCAGCCAGGAGGAAGTTAGGTCATACTCAGATCCCCCTCTGAAGTTCATGTCCGTGCAGCGGCCAGGGCCCTATGACCGGCCCGGGACTGCCAGGAGGTACATTGGCATCGTGAAGCAGGCAGGCCTGGAAAGGATGAGGCCTGGTGCCTACAGCACAGGCTACGGGGGCTACGAGGAGTACAGTGGCCTCAGTGATGGCTACGGCTTCACCACCGACCTGTTCGGGAGAGACCTCAGCTACTGTCTCTCCGGAATGTATGACCACAGATACGGCGACAGTGAGTTCACAGTGCAGAGCACCACAGGCCACTGTGTCCACATGAGGGGCCTGCCGTACAAAGCGACCGAGAACGACATTTACAACTTCTTCTCTCCTCTCAACCCTGTGAGAGTCCATATTGAGATTGGCCCAGATGGAAGAGTGACGGGTGAAGCAGATGTTGAGTTTGCTACTCATGAAGAAGCTGTGGCAGCTATGTCCAAAGACAGGGCCAATATGCAGCACAGATATATAGAACTCTTCTTGAATTCAACAACAGGGGCCAGCAATGGGGCGTATAGCAGCCAGGTGATGCAAGGCATGGGGGTGTCTGCTGCCCAGGCCACTTACAGTGGCCTGGAGAGCCAGTCAGTGAGTGGCTGTTACGGGGCCGGCTACAGTGGGCAGAACAGCATGGGTGGCTATGACTAGTTTTGTTAGGAACATTTGAGTTACTTCAATCATTTTCACAGGCAGCCAACAAGCAATTAAGAGCAGTTATAATAGAGGAAGCTGGGGGACCCATTTTGCACCATGAGTTTGTGAAAAATCTGGATTAAAAAATTACCTCTTCAGTGTTTTCTCATGCAAAATTTTCTTCTAGCATGTGATAATGAGTAAACTAAAACTATTTTCAGCTTTTCTCAATTAACATTTTGGTAGTATACTTCAGAGTGATGTTATCTAAGTTTAAGTAGTTTAAGTATGTTAAATGTGGATCTTTTACACCACATCACAGTGAACACACTGGGGAGACGTGCTTTTTTGGAAAACTCAAAGGTGCTAGCTCCCTGATTCAAAGAAATATTTCTCATGTTTGTTCATTCTAGTTTATATTTTCATTTAAAATCCTTTAGGTTAAGTTTAAGCTTTTTAAAAGTTAGTTTTGAGAATTGAGACACAATACTAATACTGTAGGAATTGGTGAGGCCTTGACTTAAAACTTTCTTTGTACTGTGATTTCCTTTTGGGTGTATTTTGCTAAGTGAAACTTGTTAAATTTTTTGTTAACTAAATTTTTTTCTTAAAATAAAGACTTTTTCACAATGACTGGCACAGATTACTCAGCAAAAGATAGCAAAACGGGTGGTTGAAGATAATTCATTTTAATCGTAATGTATTTTAGTGTGAATTTAAAAATTTCATACATCAAATCTATGATCTCCCTTATATTCTTATGATGAGGCTAAATAAAAGTCTAATAAAAATGTTAAATATGTGAATGGTGGAAATGGTGACTAGCAGCACACATTCTGGGAAGCATCAAATAGACACACGGCCCCAGCCACCTGCAACTTATGTGCACTGTTGTAAACCATTCAGAATTTTCCTGCTAGGCCCTTGATGCTGGAGTCACATCTGTTGATAGCTGGAGAACTTTAGTTTCAAGTACTACATTGTGAAAGCAATTATTTTGTTTCTAGTTTTTATAAAATGCTG