Transcript asmbl_15371

Sequence
Transcript Sequence for observation asmbl_15371 of TGE0003252:
CTCCCGTCCCTGCCCCCACTCTCCCCGCTGCGCCGCTCGCTCCGCCCCCCGCCCGGAAGCTCCCGCCCGAGCCCGCGCAGGCCCTGGGGCCGACCTTCCTGCCGGGCCGGGCGGTCCGAGGCTGCTGGAGTGCCGTGAGCAGGCCGCGGGAACGTCGCCGTCACCTTGTCTCGGGGCCTCGGCGCTGCTTCCCGCCAAAACACGTTTACCGCGCGCCCGGGCCTCCCACCTTGCGGAAGGGACCCCACCACCACTTGGATTTCTGTTGCAGGTTGAGAACAAAAACATGCACCTGGAGTTTCCCCGGAGCCCTCTGCGTGGTTGAGCTTCGGTGGAATTTCGGGGCTCTTGGCTGCCAGCCGCGCTTGCCTGGTAGCAACAGAAACCAGTCCTGCTCGCCTCCGTGGACATTTCATTACCATCCAGAAGTGTCTCCCACTGAAGGCATCCGTGGTTGTTTTTAAGCCACAAAAAAGCCACACCCAAGATCACCTGACACCCACCCTGACAAGTGTCCATGATGCTGGGCCCTGAGGGAGGTGAAGGCTTTGTGGTCAAGCTCCGTGGCCTGCCCTGGTCCTGCTCTGTTGAGGACGTGCAGAACTTCCTCTCTGACTGCACGATTCATGATGGGGCCGCAGGTGTCCATTTCATCTACACTAGAGAGGGCAGGCAGAGTGGTGAGGCTTTTGTTGAACTTGGATCAGAAGATGATGTAAAAATGGCCCTGAAAAAAGACAGGGAAAGCATGGGACACCGGTACATTGAGGTGTTCAAGTCCCACAGAACCGAGATGGATTGGGTGTTGAAGCACAGTGGTCCCAACAGTGCCGACAGCGCCAACGATGGCTTCGTGCGGCTTCGAGGACTCCCATTTGGATGCACAAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATTGTGCCAAACGGGATCACATTGCCTGTGGACCCCGAAGGCAAGATTACAGGGGAAGCGTTCGTGCAGTTTGCCTCGCAGGAGTTAGCTGAGAAGGCTCTAGGGAAACACAAGGAGAGGATAGGGCACAGGTACATTGAGGTGTTTAAGAGCAGCCAGGAGGAAGTTAGGTCATACTCAGATCCCCCTCTGAAGTTCATGTCCGTGCAGCGGCCAGGGCCCTATGACCGGCCCGGGACTGCCAGGAGGTACATTGGCATCGTGAAGCAGGCAGGCCTGGAAAGGATGAGGCCTGGTGCCTACAGCACAGGCTACGGGGGCTACGAGGAGTACAGTGGCCTCAGTGATGGCTACGGCTTCACCACCGACCTGTTCGGGAGAGACCTCAGCTACTGTCTCTCCGGAATGTATGACCACAGATACGGCGACAGTGAGTTCACAGTGCAGAGCACCACAGGCCACTGTGTCCACATGAGGGGCCTGCCGTACAAAGCGACCGAGAACGACATTTACAACTTCTTCTCTCCTCTCAACCCTGTGAGAGTCCATATTGAGATTGGCCCAGATGGAAGAGTGACGGGTGAAGCAGATGTTGAGTTTGCTACTCATGAAGAAGCTGTGGCAGCTATGTCCAAAGACAGGGCCAATATGCAGCACAGATATATAGAACTCTTCTTGAATTCAACAACAGGGGCCAGCAATGGGGCGTATAGCAGCCAGGTGATGCAAGGCATGGGGGTGTCTGCTGCCCAGGCCACTTACAGTGGCCTGGAGAGCCAGTCAGTGAGTGGCTGTTACGGGGCCGGCTACAGTGGGCAGAACAGCATGGGTGGCTATGACTAGTTTTGTTAGGAACATTTGAGTTACTTCAATCATTTTCACAGGCAGCCAACAAGCAATTAAGAGCAGTTATAATAGAGGAAGCTGGGGGACCCATTTTGCACCATGAGTTTGTGAAAAATCTGGATTAAAAAATTACCTCTTCAGTGTTTTCTCATGCAAAATTTTCTTCTAGCATGTGATAATGAGTAAACTAAAACTATTTTCAGCTTTTCTCAATTAACATTTTGGTAGTATACTTCAGAGTGATGTTATCTAAGTTTAAGTAGTTTAAGTATGTTAAATGTGGATCTTTTACACCACATCACAGTGAACACACTGGGGAGACGTGCTTTTTTGGAAAACTCAAAGGTGCTAGCTCCCTGATTCAAAGAAATATTTCTCATGTTTGTTCATTCTAGTTTATATTTTCATTTAAAATCCTTTAGGTTAAGTTTAAGCTTTTTAAAAGTTAGTTTTGAGAATTGAGACACAATACTAATACTGTAGGAATTGGTGAGGCCTTGACTTAAAACTTTCTTTGTACTGTGATTTCCTTTTGGGTGTATTTTGCTAAGTGAAACTTGTTAAATTTTTTGTTAACTAAATTTTTTTCTTAAAATAAAGACTTTTTCACAATGACTGGCACAGATTACTCAGCAAAAGATAGCAAAACGGGTGGTTGAAGATAATTCATTTTAATCGTAATGTATTTTAGTGTGAATTTAAAAATTTCATACATCAAATCTATGATCTCCCTTATATTCTTATGATGAGGCTAAATAAAAGTCTAATAAAAATGTTAAATATGTGAATGGTGGAAATGGTGACTAGCAGCACACATTCTGGGAAGCATCAAATAGACACACGGCCCCAGCCACCTGCAACTTATGTGCACTGTTGTAAACCATTCAGAATTTTCCTGCTAGGCCCTTGATGCTGGAGTCACATCTGTTGATAGCTGGAGAACTTTAGTTTCAAGTACTACATTGTGAAAGCAATTATTTTGTTTCTAGTTTTTATAAAATGCTG