Transcript asmbl_15370

Sequence
Transcript Sequence for observation asmbl_15370 of TGE0003252:
TGCGTCCTTCCGGCTCCGTCGTGGAAGCAGGACTGCGCCGCGTCTTCCTCAAGGTTGAGAACAAAAACATGCACCTGGAGTTTCCCCGGAGCCCTCTGCGTGGTTGAGCTTCGGTGGAATTTCGGGGCTCTTGGCTGCCAGCCGCGCTTGCCTGGTAGCAACAGAAACCAGTCCTGCTCGCCTCCGTGGACATTTCATTACCATCCAGAAGTGTCTCCCACTGAAGGCATCCGTGGTTGTTTTTAAGCCACAAAAAAGCCACACCCAAGATCACCTGACACCCACCCTGACAAGTGTCCATGATGCTGGGCCCTGAGGGAGGTGAAGGCTTTGTGGTCAAGCTCCGTGGCCTGCCCTGGTCCTGCTCTGTTGAGGACGTGCAGAACTTCCTCTCTGACTGCACGATTCATGATGGGGCCGCAGGTGTCCATTTCATCTACACTAGAGAGGGCAGGCAGAGTGGTGAGGCTTTTGTTGAACTTGGATCAGAAGATGATGTAAAAATGGCCCTGAAAAAAGACAGGGAAAGCATGGGACACCGGTACATTGAGGTGTTCAAGTCCCACAGAACCGAGATGGATTGGGTGTTGAAGCACAGTGGTCCCAACAGTGCCGACAGCGCCAACGATGGCTTCGTGCGGCTTCGAGGACTCCCATTTGGATGCACAAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATTGTGCCAAACGGGATCACATTGCCTGTGGACCCCGAAGGCAAGATTACAGGGGAAGCGTTCGTGCAGTTTGCCTCGCAGGAGTTAGCTGAGAAGGCTCTAGGGAAACACAAGGAGAGGATAGGGCACAGGTACATTGAGGTGTTTAAGAGCAGCCAGGAGGAAGTTAGGTCATACTCAGATCCCCCTCTGAAGTTCATGTCCGTGCAGCGGCCAGGGCCCTATGACCGGCCCGGGACTGCCAGGAGGTACATTGGCATCGTGAAGCAGGCAGGCCTGGAAAGGATGAGGCCTGGTGCCTACAGCACAGGCTACGGGGGCTACGAGGAGTACAGTGGCCTCAGTGATGGCTACGGCTTCACCACCGACCTGTTCGGGAGAGACCTCAGCTACTGTCTCTCCGGAATGTATGACCACAGATACGGCGACAGTGAGTTCACAGTGCAGAGCACCACAGGCCACTGTGTCCACATGAGGGGCCTGCCGTACAAAGCGACCGAGAACGACATTTACAACTTCTTCTCTCCTCTCAACCCTGTGAGAGTCCATATTGAGATTGGCCCAGATGGAAGAGTGACGGGTGAAGCAGATGTTGAGTTTGCTACTCATGAAGAAGCTGTGGCAGCTATGTCCAAAGACAGGGCCAATATGCAGCACAGATATATAGAACTCTTCTTGAATTCAACAACAGGGGCCAGCAATGGGGCGTATAGCAGCCAGGTGATGCAAGGCATGGGGGTGTCTGCTGCCCAGGCCACTTACAGTGGCCTGGAGAGCCAGTCAGTGAGTGGCTGTTACGGGGCCGGCTACAGTGGGCAGAACAGCATGGGTGGCTATGACTAGTTTTGTTAGGAACATTTGAGTTACTTCAATCATTTTCACAGGCAGCCAACAAGCAATTAAGAGCAGTTATAATAGAGGAAGCTGGGGGACCCATTTTGCACCATGAGTTTGTGAAAAATCTGGATTAAAAAATTACCTCTTCAGTGTTTTCTCATGCAAAATTTTCTTCTAGCATGTGATAATGAGTAAACTAAAACTATTTTCAGCTTTTCTCAATTAACATTTTGGTAGTATACTTCAGAGTGATGTTATCTAAGTTTAAGTAGTTTAAGTATGTTAAATGTGGATCTTTTACACCACATCACAGTGAACACACTGGGGAGACGTGCTTTTTTGGAAAACTCAAAGGTGCTAGCTCCCTGATTCAAAGAAATATTTCTCATGTTTGTTCATTCTAGTTTATATTTTCATTTAAAATCCTTTAGGTTAAGTTTAAGCTTTTTAAAAGTTAGTTTTGAGAATTGAGACACAATACTAATACTGTAGGAATTGGTGAGGCCTTGACTTAAAACTTTCTTTGTACTGTGATTTCCTTTTGGGTGTATTTTGCTAAGTGAAACTTGTTAAATTTTTTGTTAACTAAATTTTTTTCTTAAAATAAAGACTTTTTCACAATGACTGGCACAGATTACTCAGCAAAAGATAGCAAAACGGGTGGTTGAAGATAATTCATTTTAATCGTAATGTATTTTAGTGTGAATTTAAAAATTTCATACATCAAATCTATGATCTCCCTTATATTCTTATGATGAGGCTAAATAAAAGTCTAATAAAAATGTTAAATATGTGAATGGTGGAAATGGTGACTAGCAGCACACATTCTGGGAAGCATCAAATAGACACACGGCCCCAGCCACCTGCAACTTATGTGCACTGTTGTAAACCATTCAGAATTTTCCTGCTAGGCCCTTGATGCTGGAGTCACATCTGTTGATAGCTGGAGAACTTTAGTTTCAAGTACTACATTGTGAAAGCAATTATTTTGTTTCTAGTTTTTATAAAATGCTG