Transcript asmbl_15331

Sequence
Transcript Sequence for observation asmbl_15331 of TGE0057957:
TTTCTATAAGAAGCATATGCTGGTTTTATAATCTCAGAAAAGATACGTTGGAGACAGTCTGTATTAGCGCTTACCATGTAGAAGGCATACTCTTCCTTAGGTAGATGCAAAGAAACCTAAAACATACTTTGAACATAGAGCCTGAGAAATTCTGGGATTATGGATTAGATGAATATGGACTTTTCAGTTATTTAACATACTGAAAGCAAAGGGAAAGCCTTGAAGATTCTTATGAAAATAGATGTTTAAAAGCAAATGCCAAATCATGTGGAGAATGTATACAAGCAGGGCCAAATTGTGGGTGGTGCACAAATTCAACATTTTTACAGGAAGGAATGCCTACTTCTGCACGATGTGATGATTTAGAAGCCTTAAAAAAGAAGGGTTGCCCTCCAGATGACATAGAAAATCCCAGAGGCTCCAAAGATATAAAGAAAAATAAAAATGTAACCAACCGTAGCAAAGGAACAGCAGAGAAGCTCAAGCCAGAGGATATTACTCAGATCCAACCACAGCAGTTGGTTTTGCGATTAAGATCAGGGGAGCCACAGACATTTACATTAAAATTCAAGAGAGCTGAAGACTATCCCATTGACCTCTACTACCTTATGGACCTGTCTTACTCAATGAAAGACGATTTGGAGAATGTAAAAAGTCTTGGAACAGATCTGATGAATGAAATGAGGAGGATTACTTCGGACTTCAGAATTGGATTTGGCTCATTTGTGGAAAAGACTGTGATGCCTTACATTAGCACAACACCAGCTAAGCTCAGGAACCCTTGCACAAGTGAACAGAACTGCACCAGCCCATTTAGCTACAAAAATGTGCTCAGTCTTACTAATAAAGGAGAAGTATTTAATGAACTTGTTGGAAAACAGCGCATATCTGGAAATTTGGATTCTCCAGAAGGTGGTTTCGATGCCATCATGCAAGTTGCAGTTTGTGGATCACTGATTGGCTGGAGGAATGTTACACGGCTGCTGGTGTTTTCCACAGATGCCGGGTTTCACTTTGCTGGAGATGGGAAACTTGGTGGCATTGTTTTACCAAATGATGGACAATGTCACCTGGAAAATAATATGTACACAATGAGCCATTATTATGATTATCCTTCTATTGCTCACCTTGTCCAGAAACTGAGTGAAAATAATATTCAGACAATTTTTGCAGTTACTGAAGAATTTCAGCCTGTTTACAAGGAGCTGAAAAACTTGATCCCTAAGTCAGCAGTAGGAACATTATCTGCAAATTCTAGCAATGTAATTCAGTTGATCATTGATGCATACAATTCCCTTTCCTCAGAAGTCATTTTGGAAAACGGCAAATTGTCAGAAGGCGTAACAATAAGTTACAAATCTTACTGCAAGAACGGGGTGAATGGAACAGGGGAAAATGGAAGAAAATGTTCCAATATTTCCATTGGAGATGAGGTTCAATTTGAAATTAGCATAACTTCAAATAAGTGTCCAAAAAAGGATTCTGACAGCTTTAAAATTAGGCCTCTGGGCTTTACGGAGGAAGTAGAGGTTATTCTTCAGTACATCTGTGAATGTGAATGCCAAAGCGAAGGCATCCCTGAAAGTCCCAAGTGTCATGAAGGAAATGGGACATTTGAGTGTGGCGCGTGCAGGTGCAATGAAGGGCGTGTTGGTAGACATTGTGAATGCAGCACAGATGAAGTTAACAGTGAAGACATGGATGCTTACTGCAGGAAAGAAAACAGTTCAGAAATCTGCAGTAACAATGGAGAGTGCGTCTGCGGACAGTGTGTTTGTAGGAAGAGGGATAATACAAATGAAATTTATTCTGGCAAATTCTGCGAGTGTGATAATTTCAACTGTGATAGATCCAATGGCTTAATTTGTGGAGGAAATGGTGTTTGCAAGTGTCGTGTGTGTGAGTGCAACCCCAACTACACTGGCAGTGCATGTGACTGTTCTTTGGATACTAGTACTTGTGAAGCCAGCAACGGACAGATCTGCAATGGCCGGGGCATCTGCGAGTGTGGTGTCTGTAAGTGTACAGATCCGAAGTTTCAAGGGCAAACGTGTGAGATGTGTCAGACCTGCCTTGGTGTCTGTGCTGAGCATAAAGAATGTGTTCAGTGCAGAGCCTTCAATAAAGGAGAAAAGAAAGACACATGCACACAGGAATGTTCCTATTTTAACATTACCAAGGTAGAAAGTCGGGACAAATTACCCCAGCCGGTCCAACCTGATCCTGTGTCCCATTGTAAGGAGAAGGATGTTGACGACTGTTGGTTCTATTTTACGTATTCAGTGAATGGGAACAACGAGGTCATGGTTCATGTTGTGGAGAATCCAGAGTGTCCCACTGGTCCAGACATCATTCCAATTGTAGCTGGTGTGGTTGCTGGAATTGTTCTTATTGGCCTTGCATTACTGCTGATATGGAAGCTTTTAATGATAATTCATGACAGAAGGGAGTTTGCTAAATTTGAAAAGGAGAAAATGAATGCCAAATGGGACACGGGTGAAAATCCTATTTATAAGAGTGCCGTAACAACTGTGGTCAATCCGAAGTATGAGGGAAAATGAGTACTGCCCGTGCAAATCCCACAACACTGAATGCAAAGTAGCAATTTCCATAGTCACAGTTAGGTAGCTTTAGGGCAATATTGCCATGGTTTTACTCATGTGCAGGTTTTGAAAATGTACAATATGTATAATTTTTAAAATGTTTTATTATTTTGAAAATAATGTTGTAATTCATGCCAGGGACTGACAAAAGACTTGAGACAGGATGGTTACTCTTGTCAGCTAAGGTCACATTGTGCCTTTTTGACCTTTTCTTCCTGGACTATTGAAATCAAGCTTATTGGATTAAGTGATATTTCTATAGCGATTGAAAGGGCAATAGTTAAAGTAATGAGCATGATGAGAGTTTCTGTTAATCATGTATTAAAACTGATTTTTAGCTTTACAAATATGTCAGTTTGCAGTTATGCAGAATCCAAAGTAAATGTCCTGCTAGCTAGTTAAGGATTGTTTTAAATCTGTTATTTTGCTATTTGCCTGTTAGACATGACTGATGACATATCTGAAAGACAAGTATGTTGAGAGTTGCTGGTGTAAAATACGTTTGAAATAGTTGATCTACAAAGGCCATGGGAAAAATTCAGAGAGTTAGGAAGGAAAAACCAATAGCTTTAAAACCTGTGTGCCATTTTAAGAGTTACTTAATGTTTGGTAACTTTTATGCCTTCACTTTACAAATTCAAGCCTTAGATAAAAGAACCGAGCAATTTTCTGCTAAAAAGTCCTTGATTTAGCACTATTTACATACAGGCCATACTTTACAAAGTATTTGCTGAATGGGGACCTTTTGAGTTGAATTTATTTTATTATTTTTATTTTGTTTAATGTCTGGTGCTTTCTGTCACCTCTTCTAATCTTTTAATGTATTTGTTTGCAATTTTGGGGTAAGACTTTTTTTATGAGTACTTTTTCTTTGAAGTTTTAGCGGTCAATTTGCCTTTTTAATGAACATGTGAAGTTATACTGTGGCTATGCAACAGCTCTCACCTACGCGAGTCTTACTTTGAGTTAGTGCCATAACAGACCACTGTATGTTTACTTCTCACCATTTGAGTTGCCCATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTGCTATTTACTGAAGTTATTTATTAAATATGCCTAAAATACTTAAATCGGATGTCTTGACTCTGATGTATTTTATCAGGTTGTGTGCATGAAATTTTTATAGATTAAAGAAGTTGAGGAAAAG