Transcript asmbl_153135

Sequence
Transcript Sequence for observation asmbl_153135 of TGE0059599:
CTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCCGTTGTTACCGGTATTGTAAGAACAAGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTTCCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTCCTCTGAAGCCCTGGAGGCTGCCCGAATTTGTGCCAATAAGTACATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCACCCCTTCCACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGTGAGCTTGGTCTGGGCCTTTTAAGGCAGTTGGAGTCTCTACATTATTAGGCTTGCATTATTTTATCAGAGCATAGAGGTGGCCCCAGTGACTCAGCCACTATGGCTACTAGAAAAGCCAGGCTGGCAAGTGACTTTCAGTGGTCACTCAGGACCCCTTCCTGCAGATACAAACAAAGCATGAGTAAGTCTTAGCAAGCTCTTCCCCACAGGTTAGGGGAAACACTGGTGATGGGAGTAGCTCTTCTTGCTTTTAGCTGAATGACAACCATCTTGCCAGCAGGTAGCTGAAGCTGGCAGAGGAGCCCAGTGGCGCCTTTTCAGTGGTTCTTGGGATGCTCCGCAGCCAATTAAGCCGACTGAGTTCCTTTCCTCATGGGGACCCAGTGTGCGATGGCTGCACACAGCAGCTTCCTTGGTAGTGTACGCAGCCTGTTGGTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGCCTTTCAGGTGGATGTTCATGTTTCTGACCTTGCACTACCCCAATGTAGGCTCCAAACAGGCATGCGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTGGCCGCCAGAAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTCAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCCCAGTCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGAGGGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCAC