Transcript asmbl_26007

Sequence
Transcript Sequence for observation asmbl_26007 of TGE0000930:
CAGCGAGGTCGGCAGCGGCAGCGAGGTCGGCAGCGGCACAGCGAGGTCGGCAGCGGCAGCGAGGTCGGCAGCGGCGCGCGCTGTGCTCTTCCGCGGACTCTGAATCATGGCGACCACGGCCACGATGGCGACCTCGGGCTCGGCGCGAAAGCGGCTGCTCAAAGAGGAAGACATGACTAAAGTGGAATTCGAGACCAGCGAGGAGGTGGATGTGACCCCCACGTTCGACACCATGGGCCTGCGGGAGGACCTGCTGCGGGGCATCTACGCTTACGGTTTTGAAAAACCATCAGCAATCCAGCAACGAGCAATCAAGCAGATCATCAAAGGGAGAGATGTCATCGCACAGTCTCAGTCCGGCACAGGAAAAACAGCCACCTTCAGTATCTCAGTCCTCCAGTGTTTGGATATTCAGGTTCGTGAAACTCAAGCTTTGATCTTGGCTCCCACAAGAGAGTTGGCTGTGCAGATCCAGAAGGGGCTGCTTGCTCTCGGTGACTACATGAATGTCCAGTGCCATGCCTGCATTGGAGGCACCAATGTTGGCGAGGACATCAGGAAGCTGGATTACGGACAGCATGTTGTCGCGGGCACTCCAGGGCGTGTTTTTGATATGATTCGTCGCAGAAGCCTAAGGACACGTGCTATCAAAATGTTGGTTTTGGATGAAGCTGATGAAATGTTGAATAAAGGTTTCAAAGAGCAGATTTACGATGTATACAGGTACCTGCCTCCAGCCACACAGGTGGTTCTCATCAGTGCCACGCTGCCACACGAGATTCTGGAGATGACCAACAAGTTCATGACCGACCCAATCCGCATCTTGGTGAAACGTGATGAATTGACTCTGGAAGGCATCAAGCAATTTTTCGTGGCAGTGGAGAGGGAAGAGTGGAAATTTGACACTCTGTGTGACCTCTACGACACACTGACCATCACTCAGGCGGTCATCTTCTGCAACACCAAAAGAAAGGTGGACTGGCTGACGGAGAAAATGAGGGAAGCCAACTTCACTGTATCCTCAATGCATGGAGACATGCCCCAGAAAGAGCGGGAGTCCATCATGAAGGAGTTCCGGTCGGGCGCCAGCCGAGTGCTTATTTCTACAGATGTCTGGGCCAGGGGGTTGGATGTCCCTCAGGTGTCCCTCATCATTAACTATGATCTCCCTAATAACAGAGAATTGTACATACACAGAATTGGGAGATCAGGTCGATACGGCCGGAAGGGTGTGGCCATTAACTTTGTAAAGAATGACGACATCCGCATCCTCAGAGATATCGAGCAGTACTATTCCACTCAGATTGATGAGATGCCGATGAACGTTGCTGATCTTATCTGAAGCAGCAGATCAGTGGGATGAGGGAGACTGTTCACCTGCTGTGTACTCCTGTTTGGAAGTATTTAGATCCAGATTCTACTTAATGGGGTTTATATGGACTTTCTTCTCATAAATGGCCTGCCGTCTCCCTTCCTTTGAAGAGGATATGGGGATTCTGCTCTCTTTTCTTATTTACATGTAAATAATACATTGTTCTAAGTCTTTTTCATTAAAAATTTAAAACTTTTCCCATAAACTCTATACTTCTAAGGTGCCACCACCTT