Transcript asmbl_153134

Sequence
Transcript Sequence for observation asmbl_153134 of TGE0059598:
CTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCCGTTGGTGAGTCTTGAATCCGTGTACTTTCACTGCTGGGAAACGGGCGGGGAAAGAAGTGCCTATGGCCGCTGAAAACAATTGTGGGGTGGAGCCTCCCCCGTGCGGCGGCCCTGTCTTGGGAACTGACCCTATGTTTTACACCTCCCGGCTATTTTTTAGTCTGCAATATTACTGTCTGTTCCTTCGTTCCCGTGTCGGTGTGGAAGCGACGGTTCCCTCGTATCTCTGCCTGTGTCCTGCAAGCTCACCGCATTTTCGGGCGCTAGATACGCTCTTGGGGCCTTTGTGTGCGTTCTCTGTCTTATTTCCGGGCGACGTGCCGCGTGCGTTGTCGGACGTGAAGGGCAGTCCGGGAAAAACGGGTGCGGCCGCCTCCTGTGTCCTACAGGGGGCGCCAGACGCATTTCCACTCGGCTTGGAGGTGGATTTAGTGCCACGTGCCCGAAAGTCTTAAATTGGGTGACCTGAGCTGTGCAATGATAATGCGGCGATTTTGTAGTACGCAGTGTCTTGAAGAGAGAATTTTTAACTAGGAAAGTTTGTTGCAAAGTGTTTATAGGAAGCGTAAGACAAAGTAACGGAAGATGGTGTCTGTTGTTTCTAGTCTTGGGTGTTGTCTGTGTTGCAGCAGCCAACTGTTGCTTTGTAGTTTATTTCCCCGAATGGAAACGGTTTAGAAGTGGACGTGCATTCCCCACCCTTTTCCCGTCCCTCGTTTGGGTTGTTCCTTGAGGGGCAAAGTGCCTGTTGGGCTTTCTGTGAACCTCACCTAACCTGTGTTTTTTCACTCCCCTGCAGTTACCGGTATTGTAAGAACAAGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGGTAAGTAGTGGAAGAGCCCCTGCACTGGTTGGCTCTGCGGACTCCGCGTCCGTCTGTGACACCCCCTGCACACTTACCCAATCCTTTTAGATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTTCCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTCCTCTGAAGCCCTGGAGGCTGCCCGAATTTGTGCCAATAAGTACATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCACCCCTTCCACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGCTCCAAACAGGCATGCGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTGGCCGCCAGAAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTCAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCCCAGTCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGAGGGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCAC