Transcript asmbl_153133

Sequence
Transcript Sequence for observation asmbl_153133 of TGE0059599:
CTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCCGTTGGTGAGTCTTGAATCCGTGTACTTTCACTGCTGGGAAACGGGCGGGGAAAGAAGTGCCTATGGCCGCTGAAAACAATTGTGGGGTGGAGCCTCCCCCGTGCGGCGGCCCTGTCTTGGGAACTGACCCTATGTTTTACACCTCCCGGCTATTTTTTAGTCTGCAATATTACTGTCTGTTCCTTCGTTCCCGTGTCGGTGTGGAAGCGACGGTTCCCTCGTATCTCTGCCTGTGTCCTGCAAGCTCACCGCATTTTCGGGCGCTAGATACGCTCTTGGGGCCTTTGTGTGCGTTCTCTGTCTTATTTCCGGGCGACGTGCCGCGTGCGTTGTCGGACGTGAAGGGCAGTCCGGGAAAAACGGGTGCGGCCGCCTCCTGTGTCCTACAGGGGGCGCCAGACGCATTTCCACTCGGCTTGGAGGTGGATTTAGTGCCACGTGCCCGAAAGTCTTAAATTGGGTGACCTGAGCTGTGCAATGATAATGCGGCGATTTTGTAGTACGCAGTGTCTTGAAGAGAGAATTTTTAACTAGGAAAGTTTGTTGCAAAGTGTTTATAGGAAGCGTAAGACAAAGTAACGGAAGATGGTGTCTGTTGTTTCTAGTCTTGGGTGTTGTCTGTGTTGCAGCAGCCAACTGTTGCTTTGTAGTTTATTTCCCCGAATGGAAACGGTTTAGAAGTGGACGTGCATTCCCCACCCTTTTCCCGTCCCTCGTTTGGGTTGTTCCTTGAGGGGCAAAGTGCCTGTTGGGCTTTCTGTGAACCTCACCTAACCTGTGTTTTTTCACTCCCCTGCAGTTACCGGTATTGTAAGAACAAGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTTCCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTCCTCTGAAGCCCTGGAGGCTGCCCGAATTTGTGCCAATAAGTACATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCACCCCTTCCACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGTGAGCTTGGTCTGGGCCTTTTAAGGCAGTTGGAGTCTCTACATTATTAGGCTTGCATTATTTTATCAGAGCATAGAGGTGGCCCCAGTGACTCAGCCACTATGGCTACTAGAAAAGCCAGGCTGGCAAGTGACTTTCAGTGGTCACTCAGGACCCCTTCCTGCAGATACAAACAAAGCATGAGTAAGTCTTAGCAAGCTCTTCCCCACAGGTTAGGGGAAACACTGGTGATGGGAGTAGCTCTTCTTGCTTTTAGCTGAATGACAACCATCTTGCCAGCAGGTAGCTGAAGCTGGCAGAGGAGCCCAGTGGCGCCTTTTCAGTGGTTCTTGGGATGCTCCGCAGCCAATTAAGCCGACTGAGTTCCTTTCCTCATGGGGACCCAGTGTGCGATGGCTGCACACAGCAGCTTCCTTGGTAGTGTACGCAGCCTGTTGGTTGTATGGGTTGCTCTAAGGGACCTTGGAGACAGGCCTTTCAGGTGGATGTTCATGTTTCTGACCTTGCACTACCCCAATGTAGGCTCCAAACAGGCATGCGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTGGCCGCCAGAAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTCAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCCCAGTCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGAGGGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCAC