Transcript asmbl_153132

Sequence
Transcript Sequence for observation asmbl_153132 of TGE0059598:
CTGAAGATCCTGGTGTCGCCATGGGCCGCCGCCCCGCCCGTTGTTACCGGTATTGTAAGAACAAGCCGTACCCAAAGTCTCGCTTCTGCCGAGGTGTCCCTGGTAAGTAGTGGAAGAGCCCCTGCACTGGTTGGCTCTGCGGACTCCGCGTCCGTCTGTGACACCCCCTGCACACTTACCCAATCCTTTTAGATGCCAAGATTCGCATTTTTGACCTGGGGCGGAAAAAGGCAAAAGTGGATGAGTTTCCGCTTTGTGGCCACATGGTGTCAGATGAATATGAGCAGCTGTCCTCTGAAGCCCTGGAGGCTGCCCGAATTTGTGCCAATAAGTACATGGTAAAAAGTTGTGGCAAAGATGGCTTCCATATCCGGGTGCGGCTCCACCCCTTCCACGTCATCCGCATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGCTCCAAACAGGCATGCGAGGTGCCTTTGGAAAGCCCCAGGGCACTGTGGCCAGGGTTCACATTGGCCAAGTTATCATGTCCATCCGCACCAAGCTGCAGAACAAGGAGCATGTGATTGAGGCCCTGCGCAGGGCCAAGTTCAAGTTTCCTGGCCGCCAGAAGATCCACATCTCAAAGAAGTGGGGCTTCACCAAGTTCAATGCTGATGAATTTGAAGACATGGTGGCTGAAAAGCGGCTCATCCCAGATGGCTGTGGGGTCAAGTACATCCCCAGTCGTGGCCCTCTGGACAAGTGGCGGGCCCTGCACTCATGAGGGCTTCCAATGTGCTGCCCCCCTCTTAATACTCACCAATAAATTCTACTTCCTGTCCAC