Transcript asmbl_153105

Sequence
Transcript Sequence for observation asmbl_153105 of TGE0056129:
GGCCGGGAAGCCTGCCCCCTCCTGCTCGCCCGCCCTCTCCGCCCCACCAGCCCCCTCCCTCCTTTCCTCCCTCCCCGCCCTCTCCCCGCTGTCCCCTCCCCGTCGGCCCGCCTGCCCAGCCTTTAGCCTCCCGCCCGCCGCCTCTGTCTCCCTCTCTCCACAAACTGCCCAGGAGTGAGTAGCTGCTTTCGGTCCGCCGGACACACCGGACAGATAGACGTGCGGACGGCCCACCACCCCAGCCCGCCAACTAGTCAGCCTGCGCCTGGCGCCTCCCCTCTCCAGGTCCATCCGCCATGTGGCCCCTGTGGCGCCTCGTGTCTCTGCTGGCCCTGAGCCAGGCCCTGCCCTTTGAGCAGAGAGGCTTCTGGGACTTCACCCTGGACGATGGGCCATTCATGATGAACGATGAGGAAGCTTCGGGCGCTGACACCTCGGGCGTCCTGGACCCGGACTCTGTCACACCCACCTACAGCGCCATGTGTCCTTTCGGCTGCCACTGCCACCTGCGGGTGGTTCAGTGCTCCGACCTGGGTCTGAAGTCTGTGCCCAAAGAGATCTCCCCTGACACCACGCTGCTGGACCTGCAGAACAACGACATCTCCGAGCTCCGCAAGGATGACTTCAAGGGTCTCCAGCACCTCTACGCCCTCGTCCTGGTGAACAACAAGATCTCCAAGATCCATGAGAAGGCCTTCAGCCCACTGCGGAAGCTGCAGAAGCTCTACATCTCCAAGAACCACCTGGTGGAGATCCCGCCCAACCTACCCAGCTCCCTGGTGGAGCTCCGCATCCACGACAACCGCATCCGCAAGGTGCCCAAGGGAGTGTTCAGCGGGCTCCGGAACATGAACTGCATCGAGATGGGCGGGAACCCACTGGAGAACAGTGGCTTTGAACCTGGAGCCTTCGATGGCCTGAAGCTCAACTACCTGCGCATCTCAGAGGCCAAGCTGACTGGCATCCCCAAAGACCTCCCTGAGACCCTGAATGAACTCCACCTAGACCACAACAAAATCCAGGCCATCGAACTGGAGGACCTGCTTCGCTACTCCAAGCTGTACAGGCTGGGCCTAGGCCACAACCAGATCAGGATGATCGAGAACGGGAGCCTGAGCTTCCTGCCCACCCTCCGGGAGCTCCACTTGGACAACAACAAGTTGGCCAGGGTGCCCTCAGGGCTCCCAGACCTCAAGCTCCTCCAGGTGGTCTATCTGCACTCCAACAACATCACCAAAGTGGGTGTCAACGACTTCTGTCCCATGGGCTTCGGGGTGAAGCGGGCCTACTACAACGGCATCAGCCTCTTCAACAACCCCGTGCCCTACTGGGAGGTGCAGCCGGCCACTTTCCGCTGCGTCACTGACCGCCTGGCCATCCAGTTTGGCAACTACAAAAAGTAGAGGCAGCTGCAGCCACCGCGGGGCCTCAGTGGGGGTCTCTGGGGAACACAGCCAGACATCCTGATGGGGAGGCAGAGCCAGGAAGCTAAGCCAGGGCCCAGCTGCGTCCAACCCAGCCCCCCACCTCGGGTCCCTGACCCCAGCTCGATGCCCCATCACCGCCTCTCCCTGGCTCCCAAGGGTGCAGGTGGGCGCAAGGCCCGGCCCCCATCACATGTTCCCTTGGCCTCAGAGCTGCCCCTGCTCTCCCACCACAGCCACCCAGAGGCACCCCATGAAGCTTTTTTCTCGTTCACTCCCAAACCCAAGTGTCCAAGGCTCCAGTCCTAGGAGAACAGTCCCTGGGTCAGCAGCCAGGAGGCGGTCCATAAGAATGGGGACAGTGGGCTCTGCCAGGGCTGCCGCACCTGTCCAGACACACATGTTCTGTTCCTCCTCCTCATGCATTTCCAGCCTTTCAACCCTCCCCGACTCTGCGGCTCCCCTCAGCCCCCTTGCAAGTTCATGGCCTGTCCCTCCCAGACCCCTGCTCCACTGGCCCTTCGACCAGTCCTCCCTTCTGTTCTCTCTTTCCCCGTCCTTCCTCTCTCTCTCTCTCTCTCTCTC