Transcript asmbl_152827

Sequence
Transcript Sequence for observation asmbl_152827 of TGE0059597:
CTGTTCCTGCCCGCGCGGTGTTCCGCATTCTGCAAGCCTCCGGAGCGCACGTCGGCAGTCGGCTCCCTCGTTGACCGAATCACCGACCTCTCTCCCCAGCTGTATTTCCAAAATGTCGCTTTCTAACAAGCTGACGCTGGACAAGCTGGACGTTAAAGGGAAGCGGGTCGTTATGAGAGTCGACTTCAATGTTCCTATGAAGAACAACCAGATAACAAACAACCAGAGGATTAAGGCTGCTGTCCCAAGCATCAAATTCTGCTTGGACAATGGAGCCAAGTCGGTAGTCCTTATGAGCCACCTAGGCCGGCCTGATGGTGTGCCCATGCCTGACAAGTACTCCTTAGAGCCAGTTGCTGTAGAACTCAAATCTCTGCTGGGCAAGGATGTTCTGTTCTTGAAGGACTGTGTAGGCCCAGAAGTGGAGAAAGCCTGTGCCAACCCAGCTGCTGGGTCTGTCATCCTGCTGGAGAACCTCCGCTTTCATGTGGAGGAAGAAGGGAAGGGAAAAGATGCTTCTGGGAACAAGGTTAAAGCCGAGCCAGCCAAAATAGAAGCTTTCCGAGCTTCACTTTCCAAGCTAGGGGATGTCTATGTCAATGATGCTTTTGGCACTGCTCACAGAGCCCACAGCTCCATGGTAGGAGTCAATCTGCCACAGAAGGCTGGTGGGTTTTTGATGAAGAAGGAGCTGAACTACTTTGCAAAGGCCTTGGAGAGCCCAGAGCGACCCTTCCTGGCCATCCTGGGCGGAGCTAAAGTTGCAGACAAGATCCAGCTCATCAATAATATGCTGGACAAAGTCAATGAGATGATTATTGGTGGTGGAATGGCTTTTACCTTCCTTAAGGTGCTCAACAACATGGAGATTGGCACTTCTCTGTTTGATGAAGAGGGAGCCAAGATTGTCAAAGACCTAATGTCCAAAGCTGAGAAGAATGGTGTGAAGATTACCTTGCCTGTTGACTTTGTCACTGCTGACAAGTTTGATGAGAATGCCAAGACTGGCCAAGCCACTGTGGCTTCTGGCATACCTGCTGGCTGGATGGGCTTGGACTGTGGTCCTGAAAGCAGCAAGAAGTATGCTGAGGCTGTCACTCGGGCTAAGCAGATTGTGTGGAATGGTCCTGTGGGGGTATTTGAATGGGAAGCTTTTGCCCGGGGAACCAAAGCTCTCATGGATGAGGTGGTGAAAGCCACTTCTAGGGGCTGCATCACCATCATAGGTAAGCGGTCCTATACAAAGCTAATACCCATATAAGCTGGCAGAATTCTGATCAGAGGAAGGTGGAATGGAGAACTTCTTCTATGTCTCTTTATTCTGGGTAAATGTTAAGAGGTAAACAGGTAGGTAATTTACAGAGGAGCCTCTTGGTAAGATAGAGTTGGGGGTTTATCAGCTACCTTTTGGGTTGGGGAGCACACTGCCTTACAGTTTTGGTGCCAATCCCTTTTTTTTCTTTTCTCTCTTTTCCCTTTTTACCTGGCTTTCATTCAACAGGTGGTGGAGACACTGCCACTT