Transcript asmbl_152785

Sequence
Transcript Sequence for observation asmbl_152785 of TGE0059595:
CATTTTGTACCCCTTGGCAGGCACCGAGCTCCGTCGTCTCGTTTCCGGCGGTCGCGCGCTCTTTTCTCGGGACGGGAGAGGCCGTGTAGCGTCGCCGTTACTCCGAGGAGATACCAGTCGGTAGAGGAGAAGTCGAGGTTAGAGGGAACTGGGAGGCACTTTGCTGTCTGCAATCGAAGTTGAGGGTGCAAAAATGCAGAGTAATAAAACTTTTAACTTGGAGAAGCAAAACCATACTCCAAGAAAGCATCATCAACATCACCACCAGCAGCAGCACCACCAGCAGCAACAGCAGCAGCCGCCACCACCGCCAATACCTGCAAATGGGCAACAGGCCAGCAGCCAAAATGAAGGCTTGACTATTGACCTGAAGAATTTTAGAAAACCAGGAGAGAAGACCTTCACCCAACGAAGCCGTCTTTTTGTGGGAAATCTTCCTCCCGACATCACTGAGGAAGAAATGAGGAAACTATTTGAGAAATATGGAAAGGCAGGCGAAGTCTTCATTCATAAGGATAAAGGATTTGGCTTTATCCGCTTGGAAACCCGAACCCTAGCGGAGATTGCCAAAGTGGAGCTGGACAATATGCCACTCCGTGGAAAGCAGCTGCGTGTGCGCTTTGCCTGCCATAGTGCATCCCTTACAGTTCGAAACCTTCCTCAGTATGTGTCCAACGAACTGCTGGAAGAAGCCTTTTCTGTGTTTGGCCAGGTAGAGAGGGCTGTAGTCATTGTGGATGATCGAGGAAGGCCCTCAGGAAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCTCTGGACAGATGCAGTGAAGGCTCCTTCCTGCTAACCACATTTCCTCGTCCTGTGACTGTGGAGCCCATGGACCAGTTAGATGATGAAGAGGGACTTCCAGAGAAGCTGGTTATAAAAAACCAGCAATTTCACAAGGAACGAGAGCAGCCACCCAGATTTGCACAGCCTGGCTCCTTTGAGTATGAATATGCCATGCGCTGGAAGGCACTCATTGAGATGGAGAAGCAGCAGCAGGACCAAGTGGACCGCAACATCAAGGAGGCTCGTGAGAAGCTGGAGATGGAGATGGAAGCTGCACGCCATGAGCACCAGGTCATGCTAATGAGACAGGATTTGATGAGGCGCCAAGAAGAACTTCGGAGGATGGAAGAGCTGCACAACCAAGAGGTGCAAAAACGAAAGCAACTGGAGCTCAGGTAACTTTTCTCGAACACTTTTTCCCTAACAACTCTAAAAGGTAATGTCTCACTCCTCTTTCCTACTGCCATGCTACCTCGTGTATTTATAAATGTGTTGGCAAATATTTCCTGGCTGCTTCTCAGGTTCTTTCTTTGGATTGGAGATGTTTTAGCTGCCCATGGTCCTAGAAGTTACCTGCTAAAAAGAAAGCAGCTGAATGCTGGTCTCATGAGGTTTCTTTGGGGGTTGCCTCAGGGCTGGGCACACTTAACAGTGAGTTTCCTGGTGAACTGATAGTTTTCAGTAGGCCAGTCTCCTTGGTTGAGTCTCCTGTTAATCTGCTCAAGTTCTGAAATGCCTCTGTCTTAAATACATTGGTGACTCTCTGTAGGCAGGAGGAAGAGCGCAGGCG