Transcript asmbl_15230

Sequence
Transcript Sequence for observation asmbl_15230 of TGE0059594:
TAACGAACGTGATTAGCCAGCCTCTTCCACAGACTTTTAAGGGCGGAGCCTGGCCCTGGAGACACGTCTGGAGAGCTGTTCTCCTAATATGGGTAGGGTCGGGCGTGGAGCTGGCAGCGGCGCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGGTGAGTGTGTGCGGTGTTGCACTTGGGGTTGCTTCTCGCTGCGTGGCCGCAGCGGGGCTGAACCCTTCCCACTCCATCCCCTCCCCGCACCCGGACCAGCCCCTGGGACGCCCTCGGACGCCCACCCGCTCCAACCCTGGGGAAGCCTCAGAGTGGCAGCGAAGGCCTCTTGCCTTTCCGCCTCTGCGCTTGCTGTCATCGCCCACGTGCTTTGTTGTTGTTCGGTGCAGACCATGTCCAAGTCTCTGAAGAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCCGAGGTGGACATGAGTGACCGGGGCATCTCCAACATGCTGGATGTCAACGGCCTCTTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAACAAGCTAACAATGGTGCCACCGAACATCGCAGAACTGAAGAATTTGGAGGTGCTCAACTTTTTTAATAACCAAATCGAGGAGCTGCCCACACAGATCAGTAGCCTTCAGAAACTCAAACACCTGAACCTTGGCATGAACAGGCTGAACACTTTGCCACGAGGCTTCGGCTCCCTGCCAGCTCTTGAGGTTCTGGACTTGACGTACAACAACTTGAGCGAAAATTCTCTTCCTGGAAACTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACCCAGCTTAAAGAGCTCCACATTCAGGGGAACCGCCTCACCGTTCTGCCCCCAGAACTAGGAAACTTGGATTTAACTGGCCAGAAGCAGGTATTCAAAGCAGAGAACAATCCCTGGGTGACCCCCATTGCAGACCAGTTCCAGCTTGGCGTGTCCCATGTTTTTGAGTATATCCGTTCTGAGACATACAAATACCTCTACGGCAGACACATGCAGGCCAACCCAGAACCACCGAAGAAGAATAATGACAAATCGAAAAAGATCAGCCGGAAACCCCTGGCAGCCAAGAACAGATAAGGAAGGGATTGGCATCGGCTGGCCTTCCAGCACCTTCTCTCTCCAACACTTCATTCTCTCTTGCCCTGTCTCTCAAATAAACCCAATGCTGCGTGTGAGGCCTTTTTTATTTTTCTTTTCACTCTCTTTCTAATGCTTCCCACCTTACCTTTTAGATTCTTTTGCTAGGTGGGAGATTGTTATAAGGTCTTTAAACCATTTCCATTTGTTTCTTTAACATTACCAAAAGCAGGGAACAAAGCTCTTATTCAACTGCGAATTCCATAGTGGGCTCTGGCTTTTCTTGAATAGATATCACAAGGTTGCTTATTATCAAAAGAATAATTAAAATCATGTAACCATTTAAATGTCACTGTTAACACTTTTCACTCTTTCTGTTGATTCACCTAACTCATTATTTTGCTTTATTAAAAGTCTTCCTTCACCACCGAGATATGCTAATTTAACTTACAAATGATTTTAATAAAATCTTGAGTTTGTATCACATGTTACTTATTGACTCAGAATAAAAGAACAGTCTGATCTTGGGGTATAACACATTTTCATTTACTTTTCTCCCCCAAAATCATCTTATCCAATTTTATTGGTTATACATGATAAACTTTTCATGAAAGAAATGCAAAATTAAATCACAGTTCGTTTCTTCTCACATTAATTTGTCAAGTTTTTTTTTTCTTTGAAGACTTTCTAAATTAGGAAGCAGAAAAACAAATCTCTAGGAGATTCTGCCAAAGGATTTTGGAAAGTAGCATTCCTTCGCCGAAGAAATGGTGATTTCTGCCAGGGGCTGGTAGACAAGAACTGTGAAAGAGAGAGAGAAAAAACCTCAACTGTGTATTTTGTCACGGCGGAAAATCTGCTCGCATCGAAGCATTCTTCTAAGCGACTTCGATGCCAAGGAAGTTGTGTAAATGTGCACGCGCTACACCACACCCAGGGTGGAAACCACAGTTGCAGAGTCATTAAACAATCAATTGTTTGTTTAACATCTGTGATAGGCAGCTTTCCTTCTTTTCAACAGTGATACCTACGAAAATCAAAATAAATGCAAGCTGAGGTTTTGTGCTCACTGAAAGGGCTGTCAACCCCAGAAGGCCGACACAAAAAAAATGGTATGTGAAGATGCACCGTCTTTTCAAATGGCCTGGGAGAGTCAAATGGCCTGGGAGAGGGGGCCTGCCCTTCTCTGCTGTGTCCTTTCGGCTTCCCAGTTGAGCTCCCAAGACCAGGACCCACTGGGGCATATAAAA