Transcript asmbl_15229

Sequence
Transcript Sequence for observation asmbl_15229 of TGE0003243:
TAACGAACGTGATTAGCCAGCCTCTTCCACAGACTTTTAAGGGCGGAGCCTGGCCCTGGAGACACGTCTGGAGAGCTGTTCTCCTAATATGGGTAGGGTCGGGCGTGGAGCTGGCAGCGGCGCTGTGTGCGCCTGCGCGGGGCGCCGAGACAGGGCGTGTTCGCTGTTCAGTGCCGGTGTTGCAGGGAGTGAGGGCAGCTGGAGTGCGTTCTGCCGAAGCTTGTGGTTGCACGCCCATCGTCTTAGGGGCTACCTTCCGTGACCATGTCCAAGTCTCTGAAGAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCCGAGGTGGACATGAGTGACCGGGGCATCTCCAACATGCTGGATGTCAACGGCCTCTTTACCTTATCCCATATCACACAACTGGTCCTCAGCCATAACAAGCTAACAATGGTGCCACCGAACATCGCAGAACTGAAGAATTTGGAGGTGCTCAACTTTTTTAATAACCAAATCGAGGAGCTGCCCACACAGATCAGTAGCCTTCAGAAACTCAAACACCTGAACCTTGGCATGAACAGGCTGAACACTTTGCCACGAGGCTTCGGCTCCCTGCCAGCTCTTGAGGTTCTGGACTTGACGTACAACAACTTGAGCGAAAATTCTCTTCCTGGAAACTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACCCAGCTTAAAGAGCTCCACATTCAGGGGAACCGCCTCACCGTTCTGCCCCCAGAACTAGGAAACTTGGATTTAACTGGCCAGAAGCAGGTATTCAAAGCAGAGAACAATCCCTGGGTGACCCCCATTGCAGACCAGTTCCAGCTTGGCGTGTCCCATGTTTTTGAGTATATCCGTTCTGAGACATACAAATACCTCTACGGCAGACACATGCAGGCCAACCCAGAACCACCGAAGAAGAATAATGACAAATCGAAAAAGATCAGCCGGAAACCCCTGGCAGCCAAGAACAGATAAGGAAGGGATTGGCATCGGCTGGCCTTCCAGCACCTTCTCTCTCCAACACTTCATTCTCTCTTGCCCTGTCTCTCAAATAAACCCAATGCTGCGTGTGAGGCCTTTTTTATTTTTCTTTTCACTCTCTTTCTAATGCTTCCCACCTTACCTTTTAGATTCTTTTGCTAGGTGGGAGATTGTTATAAGGTCTTTAAACCATTTCCATTTGTTTCTTTAACATTACCAAAAGCAGGGAACAAAGCTCTTATTCAACTGCGAATTCCATAGTGGGCTCTGGCTTTTCTTGAATAGATATCACAAGGTTGCTTATTATCAAAAGAATAATTAAAATCATGTAACCATTTAAATGTCACTGTTAACACTTTTCACTCTTTCTGTTGATTCACCTAACTCATTATTTTGCTTTATTAAAAGTCTTCCTTCACCACCGAGATATGCTAATTTAACTTACAAATGATTTTAATAAAATCTTGAGTTTGTATCACATGTTACTTATTGACTCAGAATAAAAGAACAGTCTGATCTTGGGGTATAACACATTTTCATTTACTTTTCTCCCCCAAAATCATCTTATCCAATTTTATTGGTTATACATGATAAACTTTTCATGAAAGAAATGCAAAATTAAATCACAGTTCGTTTCTTCTCACATTAATTTGTCAAGTTTTTTTTTTCTTTGAAGACTTTCTAAATTAGGAAGCAGAAAAACAAATCTCTAGGAGATTCTGCCAAAGGATTTTGGAAAGTAGCATTCCTTCGCCGAAGAAATGGTGATTTCTGCCAGGGGCTGGTAGACAAGAACTGTGAAAGAGAGAGAGAAAAAACCTCAACTGTGTATTTTGTCACGGCGGAAAATCTGCTCGCATCGAAGCATTCTTCTAAGCGACTTCGATGCCAAGGAAGTTGTGTAAATGTGCACGCGCTACACCACACCCAGGGTGGAAACCACAGTTGCAGAGTCATTAAACAATCAATTGTTTGTTTAACATCTGTGATAGGCAGCTTTCCTTCTTTTCAACAGTGATACCTACGAAAATCAAAATAAATGCAAGCTGAGGTTTTGTGCTCACTGAAAGGGCTGTCAACCCCAGAAGGCCGACACAAAAAAAATGGTATGTGAAGATGCACCGTCTTTTCAAATGGCCTGGGAGAGTCAAATGGCCTGGGAGAGGGGGCCTGCCCTTCTCTGCTGTGTCCTTTCGGCTTCCCAGTTGAGCTCCCAAGACCAGGACCCACTGGGGCATATAAAA