Transcript asmbl_149411

Sequence
Transcript Sequence for observation asmbl_149411 of TGE0003099:
CGTCTTAGCGGCTGCGCGGTGGCTGCTCCGTCCTTTCGGTCCAGGCGGCGGCAGGGCTGAGCCAGCGACGCCCTCCATTCACTCTCCGCGCCCGTTCTCCGGCTGTCCTCCCGTTCCGCTGCCCGCCCTGCCACCATGACGGAACAGGCCATCTCCTTCGCCAAAGACTTCTTGGCCGGAGGCATCGCCGCCGCCATCTCCAAGACGGCCGTGGCTCCGATCGAGCGGGTCAAGCTGCTGCTGCAGGTCCAGCACGCCAGCAAGCAGATCGCCGCCGACAAGCAGTACAAGGGCATCGTGGACTGCATTGTCCGCATCCCCAAGGAGCAGGGCGTGCTGTCCTTCTGGAGGGGCAACCTTGCCAACGTCATTCGCTACTTCCCCACTCAAGCCCTCAACTTCGCCTTCAAGGATAAGTACAAGCAGATCTTCCTGGGGGGCGTGGACAAGCACACGCAGTTCTGGAGGTACTTTGCGGGCAACCTGGCCTCCGGCGGTGCGGCCGGCGCGACCTCCCTCTGCTTCGTGTACCCGCTGGATTTCGCCAGAACCCGCCTGGCAGCGGACGTGGGAAAGTCAGGCACAGAGCGCGAGTTCCGAGGCCTGGGAGACTGCCTGGTGAAGATCACCAAGTCCGACGGCATCCGGGGCCTGTACCAGGGCTTCAGTGTCTCCGTGCAGGGCATCATCATCTACCGGGCGGCCTACTTCGGCGTGTACGATACGGCCAAGGGCATGCTCCCCGACCCCAAGAACACGCACATCGTGGTGAGCTGGATGATCGCGCAGACCGTGACGGCCGTGGCCGGCGTGGTGTCCTACCCCTTCGACACGGTGCGGCGGCGCATGATGATGCAGTCCGGGCGCAAAGGAGCTGACATCATGTACACGGGCACCGTCGACTGTTGGAGGAAGATCTTCAGAGATGAGGGGGGCAAGGCCTTCTTCAAGGGTGCGTGGTCCAACGTCCTGCGGGGCATGGGGGGCGCCTTCGTGCTGGTCCTGTACGACGAGCTCAAGAAGGTGATCTAAGGGCCGCGGCCTCCTCCACACACACACACACACCAGGGGAACCAAGAGAACCACGTAGAATCCTCAACCGTGCGGACCATCAACCTTCGAGAAATTCCAGTTGTCTTTTTCCCAGCCGCATCCTGCCTGTAGATGGCCGGGGAAGGCTCTAGAAAAGGGGCGCATTGCGATCCAACCATCGGCAGCCGATTCCGTGTCTTGATCACGGGGTGGGAGGGAACCGTGGCGTCCCTGCGTGGGGCCCATGGGTGAGACACTCCAGTACTGAGACCTAGAGTCCAGATGCTTGTAGGAGCCAAGTCGTGTTCTAAGTATTTATTTAAAACAAAAGAATCACGTTTTCCCATTTGTACTTCAGCGCTAGCCCCTGTTTTGCACAGCCGAGTACTGGCGAGTATGTTCTATGTTGGGCCTCCTGCTGCAAAACAATAAACAGAGGACGCAGAGGTCCTCCTGCCTGGCCACGCACCTCTCCACAGGGCGGCCTGGGGTCTGGAGATGGGCGCTGGGCCCACGGGACGCAGATGGGGCCACGCTCTGCCCGTGGCTGGCCCACGTTCCTGGTCTGCAGTGCTGCCTCCTCCCCAGCACCCCTGGGGCACAGAGGGCAGGGTCACAGCTGGGAAGAGGCGGGGGGTAGAAACCAAGGCTGGCAGAAGTGTAGCCGGGCTCCCTGATAAATGCTGGAGGACCCCAGGGCACCTGCACTTACTGTACCCTCTCTGAGAGCATTTGTATGATCTCATGTCTCAGCTCTGGAGGCTGGAGGTCCCAGAAAACCAAGGTATGGTAGATTCAGTCTCTGGTGAGTACCCAGTTCCTGGCTTCTAGATGGCGCCTTCTCCCTGTGTGTCCTCAGATGATGGATGAGGCCAGGGTGCTCTCTGGAGTCCTTTCTGTAAGGGCACTGATCCCATCCATGAGGCCTCATGACTCCCAAAGACCCCCACTTCCCAACGCCATCACTTGGGAGAGGGGCGTTTTCAGCGTGAATCTTGGGGAAACTGAAACAGGCGTGACACCCTGCGTTCCTCTCCACCTCCTGTAGCTCCCGAGGGCCACTCCAGCCCCCATTCCAGCATGAACAGTGGAGTCGGTCGGGGTCCCCAGAGTGGCAGCTGTGTGTCCGCGGGTTCACCCGTGAGAATCCACCACAAGGGGTACCCACCGCGAGGCACGACAGCTTCCTTCAAGCTCTTTCTGCTCAAACATTCATTGCGGGGCAAGAAAAGCCGTGTTGAATCTCTACCGGGCCGAACCTTGGGCCTTGGTGTCAGCGCACGGCAGGGCCACAGAGACTACAGCCCTGGGGTTCCAGAGCCGGCTCTCCCGTGCTCTCCAGAAATCCCAGCCATAGTAAAAAGAATCTGTTTTTTGAGATGGAGTCTCGCTCTCGCCCAGGCTGGAGTACAGTGGTGCAACCTCTGCCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCCAAGTAGCTGGG