Transcript asmbl_14540

Sequence
Transcript Sequence for observation asmbl_14540 of TGE0003095:
TGGGAAACTATTGTAAACTGATTTCTGGTGTCGCTGTTCCCCCTAGGTGGAGGAGAATGAGATTGAGTGCTGACTTTAAGCCTGGCTGAGAAACATACTGGCATCGATGTCATTAATGAAAGGGTGGATGTTGTTCCCCTGAAAGCCAGTGGCCTTTGACCCCTGAAGCCGCTGTGCCTGAAGGAGCTTTATTGCAGAAATGACCATTTATATCAAGCAGCTGGGCAGAAGGATTTTTGCACGAGAACATGGATCAAATAAGAAATTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAACTGTACCATCTTGGAGTGGTTGAAGCTTACTCCGGACTTACAAAGAAGAAGGAAGGAGAGACAGTGGAGCCTTACAAAGTAAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATTTTGCCCCCGCCTGAAGATCCTTCTGTGCCAGTTGCACTCAACATTGGCAAATTGGCTCAGTTCGAACCATCTCAGCGACAAAACCAAGTGGGTGTGGTTCCTTGGTCACCTCCACAATCCAACTGGAATCCTTGGACTAGTAGCAACATTGATGAGGGGCCTCTGGCTTTTGCTACTCCAGAGCAAATAAGCATGGACCTCAAGAATGAATTGATGTACCAGTTGGAACAGGATCATGATTTGCAAGCAATCTTGCAGGAGAGAGAGTTACTGCCTGTGAAGAAATTTGAAAGTGAGATTCTGGAAGCAATCAGCCAAAATTCAGTTGTCATTATTAGAGGGGCTACTGGATGTGGGAAAACCACACAGGTTCCCCAGTTCATTCTAGATGACTTTATCCAGAATGACCGAGCAGCAGAGTGTAACATCGTAGTAACTCAGCCCAGAAGAATCAGTGCGGTTTCTGTGGCAGAGCGAGTTGCATTTGAAAGAGGAGAAGAGCCTGGAAAAAGCTGTGGCTACAGCGTTCGATTTGAGTCTATACTTCCTCGTCCTCATGCCAGTATAATGTTTTGTACTGTAGGTGTGCTCCTGAGAAAATTAGAAGCAGGCATTCGAGGAATCAGTCATGTAATTGTAGATGAAATACATGAAAGAGATATTAATACTGACTTCCTTTTGGTAGTACTGCGTGATGTTGTTCAGGCTTATCCTGAAGTTCGCATTGTTCTTATGTCTGCTACTATTGATACCAGCATGTTTTGTGAATATTTCTTCAATTGCCCCATCATTGAAGTTTATGGGAGGACTTACCCAGTTCAAGAATATTTTCTGGAAGACTGCATTCAGATGACCCACTTTGTTCCTCCACCAAAAGACAAAAAGAAGAAGGATAAGGATGATGATGGTGGTGAGGATGATGATGCAAATTGCAACTTGATCTGTGGTGATGAATATGGTCCAGAAACAAGGTTGAGCATGTCTCAATTGAACGAAAAGGAAACTCCTTTTGAACTCATCGAGGCTCTACTTAAGTACATTGAAACCCTTAATGTTCCTGGAGCTGTGTTGGTTTTTTTGCCTGGCTGGAATCTGATTTATACTATGCAGAAGCATTTGGAAATGAATCCACATTTTGGAAGCCATCGGTATCAGATTCTACCCCTGCATTCTCAGATTCCTCGAGAGGAACAGCGCAAAGTGTTTGATCCAGTACCAGTTGGAGTAACCAAGGTTATTTTGTCCACAAATATTGCTGAAACAAGCATTACCATAAACGATGTTGTTTATGTCATTGACTCCTGCAAGCAGAAAGTGAAACTCTTCACTGCTCACAACAATATGACCAACTATGCTACCGTATGGGCATCAAAAACAAACCTTGAGCAACGGAAAGGGCGAGCTGGCCGAGTACGGCCTGGATTCTGCTTTCACCTGTGCAGCCGAGCTCGTTTTGAGAGACTTGAAACCCACATGACACCAGAGATGTTCCGAACACCATTGCATGAAATTGCTCTTAGCATAAAACTTCTGCGTCTAGGAGGAATTGGCCAATTTCTGGCCAAAGCAATTGAACCTCCCCCTTTGGATGCTGTGATTGAAGCAGAACACACTCTTAGAGAGCTTGATGCATTAGATGCCAATGATGAGTTGACTCCTTTGGGACGAATCCTGGCTAAACTCCCCATTGAGCCTCGTTTTGGCAAAATGATGATAATGGGGTGTATTTTCTACGTGGGAGATGCTATCTGTACCATTGCTGCTGCTACCTGCTTTCCAGAGCCTTTCATCAATGAAGGAAAGCGGCTGGGCTATATCCATCGAAATTTTGCTGGAAACAGATTTTCTGATCACGTAGCCCTTTTATCAGTATTCCAAGCCTGGGATGATGCTAGAATGGGTGGAGAAGAAGCAGAGATACGTTTTTGTGAGCACAAAAGACTTAATATGGCTACACTAAGAATGACTTGGGAAGCCAAAGTTCAGCTCAAAGAGATTTTGATTAATTCTGGGTTTCCAGAAGATTGTTTGTTGACACAAGTGTTTACTAACACTGGACCAGATAATAATTTGGATGTTGTTATCTCCCTCCTGGCCTTTGGTGTGTACCCCAATGTATGCTATCATAAGGAAAAGAGGAAGATTCTCACCACTGAAGGGCGTAATGCACTTATCCACAAATCATCTGTTAATTGTCCTTTTAGTAGCCAAGACATGAAGTACCCATCTCCCTTCTTTGTATTTGGTGAAAAGATTCGAACTCGAGCCATCTCTGCTAAAGGCATGACTTTAGTCACCCCCCTGCAGTTGCTTCTCTTTGCCTCCAAGAAAGTCCAATCTGATGGGCAGATTGTGCTTGTAGATGACTGGATTAAACTGCAAATATCTCATGAAGCTGCTGCCTGTATCACTGGTCTCCGGGCAGCCATGGAGGCTTTGGTTGTTGAAGTAACCAAACAACCTGCTATCATCAGCCAGTTGGACCCCGTAAATGAACGTATGCTGAACATGATCCGTCAGATCTCTAGACCCTCAGCTGCTGGTATCAACCTTATGATTGGCAGTACACGGTATGGAGATGGTCCACGTCCTCCCAAGATGGCCCGATACGACAATGGAAGCGGATATAGAAGGGGAGGTTCTAGTTACAGTGGTGGAGGCTATGGCGGTGGCTATAGCAGTGGAGGCTATGGTAGCGGAGGCTATGGTGGCAGCGCCAACTCCTTTCGGGCAGGATATGGTGCAGGTGTTGGTGGAGGCTATAGAGGAGTTTCCCGAGGTGGCTTTAGAGGCAACTCTGGAGGAGACTACAGAGGGCCTAGTGGAGGCTACAGAGGATCTGGGGGATTCCAGCGAGGAGGTGGTAGGGGGGCCTATGGAACTGGCTACTTTGGACAGGGAAGAGGAGGTGGCGGCTATTAAAACTTGGTTATGTCAGTTCCTGTGTGTAGACAGTAAGGAAAAAAAGGCATGCTATGTGTTACGTGTTTTTTCCAGTATGTTTATTTGCCACCAAAAAGTAAATGCATTTTCACCCATTCTGTGGTTCATTGTAGTTTAAGGAAACCAAGCATATAGATGCATTAGTGATTTTGTTTATATTATGTAAAATATAACGATCTCTTAAAAATACCACAGTTTGTATTTTTTCTTTAAGGAGTAAAGATTTGCCTTTAAATAACTTGGTATTTTCCTGGCTTTCGTTTAATACAATAGAAAATAAAGTATTACACCGAATACTTGCCGTGTAGTTTGTTTGTTGACCTCGTATGTTAGAAAATTTTACAATGCCAGCTACATCTGTTGATTTTAAATGTCAGAGAAGTTGTACCCTGTTTCAAAAGTATACTAAGTGATACTACTTGTAATAGAATAAATCATCTTGGAATTGAATTGTTACCTTTTGAAGTAAATACTGGCAAGTGCAC