Transcript asmbl_14539

Sequence
Transcript Sequence for observation asmbl_14539 of TGE0003094:
CCGCCCCCTAGCGCCGCGGTCGGAGCCATTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAAGGCCAGAGTCACACACGGTCCTAAGAGCTGGGCACCAGGAAGCGAAGGCTGATCTGAAGAAGACACTTGAATCATGGGTGACGTTAAAAATTTTCTGTATGCCTGGTGTGGCAAAAGGAAGATGACCCCATCCTATGAAATTAGAGCAGTGGGGAACAAAAACAGGCAGAAATTCATGTGTGAGGTTCAGGTGGAAGGTTATAATTACACTGGCATGGGAAATTCCACCAATAAAAAAGATGCACAAAGCAATGCTGCCAGAGACTTTGTTAACTATTTGGTTCGAATAAATGAAATAAAGAGTGAAGAAGTTCCAGCTTTTGGGGTAGCATCTCCGCCCCCACTTACTGATACTCCTGACACTACAGCAAATGCTGAAGGAGATTTACCAACAACCATGGGAGGACCTCTTCCTCCACATCTGGCTCTCAAAGCAGAAAATAATTCTGAGGTAGGGGCCTCTGGCTATGGTGTTCCTGGGCCCACCTGGGACCGAGGAGCCAACTTGAAGGATTACTACTCAAGAAAGGAAGAACAAGAAGTGCAAGCGACTCTAGAATCAGAAGAAGTGGATTTAAATGCTGGGCTTCATGGAAACTGGACCTTGGAAAATGCTAAAGCTCGTCTAAACCAATATTTTCAGAAAGAAAAGATCCAAGGAGAATATAAGTACACCCAAGTGGGTCCTGATCACAACAGGAGCTTTATTGCAGAAATGACCATTTATATCAAGCAGCTGGGCAGAAGGATTTTTGCACGAGAACATGGATCAAATAAGAAATTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAACTGTACCATCTTGGAGTGGTTGAAGCTTACTCCGGACTTACAAAGAAGAAGGAAGGAGAGACAGTGGAGCCTTACAAAGTAAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATTTTGCCCCCGCCTGAAGATCCTTCTGTGCCAGTTGCACTCAACATTGGCAAATTGGCTCAGTTCGAACCATCTCAGCGACAAAACCAAGTGGGTGTGGTTCCTTGGTCACCTCCACAATCCAACTGGAATCCTTGGACTAGTAGCAACATTGATGAGGGGCCTCTGGCTTTTGCTACTCCAGAGCAAATAAGCATGGACCTCAAGAATGAATTGATGTACCAGTTGGAACAGGATCATGATTTGCAAGCAATCTTGCAGGAGAGAGAGTTACTGCCTGTGAAGAAATTTGAAAGTGAGATTCTGGAAGCAATCAGCCAAAATTCAGTTGTCATTATTAGAGGGGCTACTGGATGTGGGAAAACCACACAGGTTCCCCAGTTCATTCTAGATGACTTTATCCAGAATGACCGAGCAGCAGAGTGTAACATCGTAGTAACTCAGCCCAGAAGAATCAGTGCGGTTTCTGTGGCAGAGCGAGTTGCATTTGAAAGAGGAGAAGAGCCTGGAAAAAGCTGTGGCTACAGCGTTCGATTTGAGTCTATACTTCCTCGTCCTCATGCCAGTATAATGTTTTGTACTGTAGGTGTGCTCCTGAGAAAATTAGAAGCAGGCATTCGAGGAATCAGTCATGTAATTGTAGATGAAATACATGAAAGAGATATTAATACTGACTTCCTTTTGGTAGTACTGCGTGATGTTGTTCAGGCTTATCCTGAAGTTCGCATTGTTCTTATGTCTGCTACTATTGATACCAGCATGTTTTGTGAATATTTCTTCAATTGCCCCATCATTGAAGTTTATGGGAGGACTTACCCAGTTCAAGAATATTTTCTGGAAGACTGCATTCAGATGACCCACTTTGTTCCTCCACCAAAAGACAAAAAGAAGAAGGATAAGGATGATGATGGTGGTGAGGATGATGATGCAAATTGCAACTTGATCTGTGGTGATGAATATGGTCCAGAAACAAGGTTGAGCATGTCTCAATTGAACGAAAAGGAAACTCCTTTTGAACTCATCGAGGCTCTACTTAAGTACATTGAAACCCTTAATGTTCCTGGAGCTGTGTTGGTTTTTTTGCCTGGCTGGAATCTGATTTATACTATGCAGAAGCATTTGGAAATGAATCCACATTTTGGAAGCCATCGGTATCAGATTCTACCCCTGCATTCTCAGATTCCTCGAGAGGAACAGCGCAAAGTGTTTGATCCAGTACCAGTTGGAGTAACCAAGGTTATTTTGTCCACAAATATTGCTGAAACAAGCATTACCATAAACGATGTTGTTTATGTCATTGACTCCTGCAAGCAGAAAGTGAAACTCTTCACTGCTCACAACAATATGACCAACTATGCTACCGTATGGGCATCAAAAACAAACCTTGAGCAACGGAAAGGGCGAGCTGGCCGAGTACGGCCTGGATTCTGCTTTCACCTGTGCAGCCGAGCTCGTTTTGAGAGACTTGAAACCCACATGACACCAGAGATGTTCCGAACACCATTGCATGAAATTGCTCTTAGCATAAAACTTCTGCGTCTAGGAGGAATTGGCCAATTTCTGGCCAAAGCAATTGAACCTCCCCCTTTGGATGCTGTGATTGAAGCAGAACACACTCTTAGAGAGCTTGATGCATTAGATGCCAATGATGAGTTGACTCCTTTGGGACGAATCCTGGCTAAACTCCCCATTGAGCCTCGTTTTGGCAAAATGATGATAATGGGGTGTATTTTCTACGTGGGAGATGCTATCTGTACCATTGCTGCTGCTACCTGCTTTCCAGAGCCTTTCATCAATGAAGGAAAGCGGCTGGGCTATATCCATCGAAATTTTGCTGGAAACAGATTTTCTGATCACGTAGCCCTTTTATCAGTATTCCAAGCCTGGGATGATGCTAGAATGGGTGGAGAAGAAGCAGAGATACGTTTTTGTGAGCACAAAAGACTTAATATGGCTACACTAAGAATGACTTGGGAAGCCAAAGTTCAGCTCAAAGAGATTTTGATTAATTCTGGGTTTCCAGAAGATTGTTTGTTGACACAAGTGTTTACTAACACTGGACCAGATAATAATTTGGATGTTGTTATCTCCCTCCTGGCCTTTGGTGTGTACCCCAATGTATGCTATCATAAGGAAAAGAGGAAGATTCTCACCACTGAAGGGCGTAATGCACTTATCCACAAATCATCTGTTAATTGTCCTTTTAGTAGCCAAGACATGAAGTACCCATCTCCCTTCTTTGTATTTGGTGAAAAGATTCGAACTCGAGCCATCTCTGCTAAAGGCATGACTTTAGTCACCCCCCTGCAGTTGCTTCTCTTTGCCTCCAAGAAAGTCCAATCTGATGGGCAGATTGTGCTTGTAGATGACTGGATTAAACTGCAAATATCTCATGAAGCTGCTGCCTGTATCACTGGTCTCCGGGCAGCCATGGAGGCTTTGGTTGTTGAAGTAACCAAACAACCTGCTATCATCAGCCAGTTGGACCCCGTAAATGAACGTATGCTGAACATGATCCGTCAGATCTCTAGACCCTCAGCTGCTGGTATCAACCTTATGATTGGCAGTACACGGTATGGAGATGGTCCACGTCCTCCCAAGATGGCCCGATACGACAATGGAAGCGGATATAGAAGGGGAGGTTCTAGTTACAGTGGTGGAGGCTATGGCGGTGGCTATAGCAGTGGAGGCTATGGTAGCGGAGGCTATGGTGGCAGCGCCAACTCCTTTCGGGCAGGATATGGTGCAGGTGTTGGTGGAGGCTATAGAGGAGTTTCCCGAGGTGGCTTTAGAGGCAACTCTGGAGGAGACTACAGAGGGCCTAGTGGAGGCTACAGAGGATCTGGGGGATTCCAGCGAGGAGGTGGTAGGGGGGCCTATGGAACTGGCTACTTTGGACAGGGAAGAGGAGGTGGCGGCTATTAAAACTTGGTTATGTCAGTTCCTGTGTGTAGACAGTAAGGAAAAAAAGGCATGCTATGTGTTACGTGTTTTTTCCAGTATGTTTATTTGCCACCAAAAAGTAAATGCATTTTCACCCATTCTGTGGTTCATTGTAGTTTAAGGAAACCAAGCATATAGATGCATTAGTGATTTTGTTTATATTATGTAAAATATAACGATCTCTTAAAAATACCACAGTTTGTATTTTTTCTTTAAGGAGTAAAGATTTGCCTTTAAATAACTTGGTATTTTCCTGGCTTTCGTTTAATACAATAGAAAATAAAGTATTACACCGAATACTTGCCGTGTAGTTTGTTTGTTGACCTCGTATGTTAGAAAATTTTACAATGCCAGCTACATCTGTTGATTTTAAATGTCAGAGAAGTTGTACCCTGTTTCAAAAGTATACTAAGTGATACTACTTGTAATAGAATAAATCATCTTGGAATTGAATTGTTACCTTTTGAAGTAAATACTGGCAAGTGCAC