Transcript asmbl_14538

Sequence
Transcript Sequence for observation asmbl_14538 of TGE0003095:
CCGCCCCCTAGCGCCGCGGTCGGAGCCATTTCGCCGATTCCTCCATGCGAGTTGCTGTGCGTTTCTCTGTTGTCTCGGTAGAAGGCCAGAGTCACACACGGTCCTAAGAGCTGGGCACCAGGAAGCGAAGGCTGATCTGAAGAAGACACTTGAATCATGGGTGACGTTAAAAATTTTCTGTATGCCTGGTGTGGCAAAAGGAAGATGACCCCATCCTATGAAATTAGAGCAGTGGGGAACAAAAACAGGCAGAAATTCATGTGTGAGGTTCAGGTGGAAGGTTATAATTACACTGGCATGGGAAATTCCACCAATAAAAAAGATGCACAAAGCAATGCTGCCAGAGACTTTGTTAACTATTTGGTTCGAATAAATGAAATAAAGAGTGAAGAAGTTCCAGCTTTTGGGGTAGCATCTCCGCCCCCACTTACTGATACTCCTGACACTACAGCAAATGCTGAAGGAGATTTACCAACAACCATGGGAGGACCTCTTCCTCCACATCTGGCTCTCAAAGCAGAAAATAATTCTGAGGTAGGGGCCTCTGGCTATGGTGTTCCTGGGCCCACCTGGGACCGAGGAGCCAACTTGAAGGATTACTACTCAAGAAAGGAAGAACAAGAAGTGCAAGCGACTCTAGAATCAGAAGAAGTGGATTTAAATGCTGGGCTTCATGGAAACTGGACCTTGGAAAATGCTAAAGCTCGTCTAAACCAATATTTTCAGAAAGAAAAGATCCAAGGAGAATATAAGTACACCCAAGTGGGTCCTGATCACAACAGGTGGAGGAGAATGAGATTGAGTGCTGACTTTAAGCCTGGCTGAGAAACATACTGGCATCGATGTCATTAATGAAAGGGTGGATGTTGTTCCCCTGAAAGCCAGTGGCCTTTGACCCCTGAAGCCGCTGTGCCTGAAGGAGCTTTATTGCAGAAATGACCATTTATATCAAGCAGCTGGGCAGAAGGATTTTTGCACGAGAACATGGATCAAATAAGAAATTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAACTGTACCATCTTGGAGTGGTTGAAGCTTACTCCGGACTTACAAAGAAGAAGGAAGGAGAGACAGTGGAGCCTTACAAAGTAAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATTTTGCCCCCGCCTGAAGATCCTTCTGTGCCAGTTGCACTCAACATTGGCAAATTGGCTCAGTTCGAACCATCTCAGCGACAAAACCAAGTGGGTGTGGTTCCTTGGTCACCTCCACAATCCAACTGGAATCCTTGGACTAGTAGCAACATTGATGAGGGGCCTCTGGCTTTTGCTACTCCAGAGCAAATAAGCATGGACCTCAAGAATGAATTGATGTACCAGTTGGAACAGGATCATGATTTGCAAGCAATCTTGCAGGAGAGAGAGTTACTGCCTGTGAAGAAATTTGAAAGTGAGATTCTGGAAGCAATCAGCCAAAATTCAGTTGTCATTATTAGAGGGGCTACTGGATGTGGGAAAACCACACAGGTTCCCCAGTTCATTCTAGATGACTTTATCCAGAATGACCGAGCAGCAGAGTGTAACATCGTAGTAACTCAGCCCAGAAGAATCAGTGCGGTTTCTGTGGCAGAGCGAGTTGCATTTGAAAGAGGAGAAGAGCCTGGAAAAAGCTGTGGCTACAGCGTTCGATTTGAGTCTATACTTCCTCGTCCTCATGCCAGTATAATGTTTTGTACTGTAGGTGTGCTCCTGAGAAAATTAGAAGCAGGCATTCGAGGAATCAGTCATGTAATTGTAGATGAAATACATGAAAGAGATATTAATACTGACTTCCTTTTGGTAGTACTGCGTGATGTTGTTCAGGCTTATCCTGAAGTTCGCATTGTTCTTATGTCTGCTACTATTGATACCAGCATGTTTTGTGAATATTTCTTCAATTGCCCCATCATTGAAGTTTATGGGAGGACTTACCCAGTTCAAGAATATTTTCTGGAAGACTGCATTCAGATGACCCACTTTGTTCCTCCACCAAAAGACAAAAAGAAGAAGGATAAGGATGATGATGGTGGTGAGGATGATGATGCAAATTGCAACTTGATCTGTGGTGATGAATATGGTCCAGAAACAAGGTTGAGCATGTCTCAATTGAACGAAAAGGAAACTCCTTTTGAACTCATCGAGGCTCTACTTAAGTACATTGAAACCCTTAATGTTCCTGGAGCTGTGTTGGTTTTTTTGCCTGGCTGGAATCTGATTTATACTATGCAGAAGCATTTGGAAATGAATCCACATTTTGGAAGCCATCGGTATCAGATTCTACCCCTGCATTCTCAGATTCCTCGAGAGGAACAGCGCAAAGTGTTTGATCCAGTACCAGTTGGAGTAACCAAGGTTATTTTGTCCACAAATATTGCTGAAACAAGCATTACCATAAACGATGTTGTTTATGTCATTGACTCCTGCAAGCAGAAAGTGAAACTCTTCACTGCTCACAACAATATGACCAACTATGCTACCGTATGGGCATCAAAAACAAACCTTGAGCAACGGAAAGGGCGAGCTGGCCGAGTACGGCCTGGATTCTGCTTTCACCTGTGCAGCCGAGCTCGTTTTGAGAGACTTGAAACCCACATGACACCAGAGATGTTCCGAACACCATTGCATGAAATTGCTCTTAGCATAAAACTTCTGCGTCTAGGAGGAATTGGCCAATTTCTGGCCAAAGCAATTGAACCTCCCCCTTTGGATGCTGTGATTGAAGCAGAACACACTCTTAGAGAGCTTGATGCATTAGATGCCAATGATGAGTTGACTCCTTTGGGACGAATCCTGGCTAAACTCCCCATTGAGCCTCGTTTTGGCAAAATGATGATAATGGGGTGTATTTTCTACGTGGGAGATGCTATCTGTACCATTGCTGCTGCTACCTGCTTTCCAGAGCCTTTCATCAATGAAGGAAAGCGGCTGGGCTATATCCATCGAAATTTTGCTGGAAACAGATTTTCTGATCACGTAGCCCTTTTATCAGTATTCCAAGCCTGGGATGATGCTAGAATGGGTGGAGAAGAAGCAGAGATACGTTTTTGTGAGCACAAAAGACTTAATATGGCTACACTAAGAATGACTTGGGAAGCCAAAGTTCAGCTCAAAGAGATTTTGATTAATTCTGGGTTTCCAGAAGATTGTTTGTTGACACAAGTGTTTACTAACACTGGACCAGATAATAATTTGGATGTTGTTATCTCCCTCCTGGCCTTTGGTGTGTACCCCAATGTATGCTATCATAAGGAAAAGAGGAAGATTCTCACCACTGAAGGGCGTAATGCACTTATCCACAAATCATCTGTTAATTGTCCTTTTAGTAGCCAAGACATGAAGTACCCATCTCCCTTCTTTGTATTTGGTGAAAAGATTCGAACTCGAGCCATCTCTGCTAAAGGCATGACTTTAGTCACCCCCCTGCAGTTGCTTCTCTTTGCCTCCAAGAAAGTCCAATCTGATGGGCAGATTGTGCTTGTAGATGACTGGATTAAACTGCAAATATCTCATGAAGCTGCTGCCTGTATCACTGGTCTCCGGGCAGCCATGGAGGCTTTGGTTGTTGAAGTAACCAAACAACCTGCTATCATCAGCCAGTTGGACCCCGTAAATGAACGTATGCTGAACATGATCCGTCAGATCTCTAGACCCTCAGCTGCTGGTATCAACCTTATGATTGGCAGTACACGGTATGGAGATGGTCCACGTCCTCCCAAGATGGCCCGATACGACAATGGAAGCGGATATAGAAGGGGAGGTTCTAGTTACAGTGGTGGAGGCTATGGCGGTGGCTATAGCAGTGGAGGCTATGGTAGCGGAGGCTATGGTGGCAGCGCCAACTCCTTTCGGGCAGGATATGGTGCAGGTGTTGGTGGAGGCTATAGAGGAGTTTCCCGAGGTGGCTTTAGAGGCAACTCTGGAGGAGACTACAGAGGGCCTAGTGGAGGCTACAGAGGATCTGGGGGATTCCAGCGAGGAGGTGGTAGGGGGGCCTATGGAACTGGCTACTTTGGACAGGGAAGAGGAGGTGGCGGCTATTAAAACTTGGTTATGTCAGTTCCTGTGTGTAGACAGTAAGGAAAAAAAGGCATGCTATGTGTTACGTGTTTTTTCCAGTATGTTTATTTGCCACCAAAAAGTAAATGCATTTTCACCCATTCTGTGGTTCATTGTAGTTTAAGGAAACCAAGCATATAGATGCATTAGTGATTTTGTTTATATTATGTAAAATATAACGATCTCTTAAAAATACCACAGTTTGTATTTTTTCTTTAAGGAGTAAAGATTTGCCTTTAAATAACTTGGTATTTTCCTGGCTTTCGTTTAATACAATAGAAAATAAAGTATTACACCGAATACTTGCCGTGTAGTTTGTTTGTTGACCTCGTATGTTAGAAAATTTTACAATGCCAGCTACATCTGTTGATTTTAAATGTCAGAGAAGTTGTACCCTGTTTCAAAAGTATACTAAGTGATACTACTTGTAATAGAATAAATCATCTTGGAATTGAATTGTTACCTTTTGAAGTAAATACTGGCAAGTGCAC