Transcript asmbl_143739

Sequence
Transcript Sequence for observation asmbl_143739 of TGE0056980:
CTGAAAAAGTGGGAAAGGATGTCTGGAGGCGAGGCGTCCCATTACAGAGGAAGGAGCTCGCTATATAAGCCAGCCAAAGTTGGCTGCACCGGCCACAGCCTGCCTACTGTCACCCGCCTCTCCCGCGCGCAGATACACGCCCCCGCCTCCGTGGGCACAAAGGCAGCGCTGCTGGGGAACTCGGGGGAACGCGCACGTGGGAACCGCCGCAGCTCCACACTCCAGGTACTTCTTCCAAGGACCTAGGTCTCTCGCCCATCGGAAAGAAAATAATTCTTTCAAGAAGATCAGGGACAACTGATTTGAAGTCTACTCTGTGCTTCTAAATCCCCAATTCTGCTGAAAGTGAGATACCCTAGAGCCCTAGAGCCCCAGCAGCACCCAGCCAAACCCACCTCCACCATGGGGGCCATGACTCAGCTGTTGGCAGGTGTCTTTCTTGCTTTCCTTGCCCTCGCTACCGAAGGTGGGGTCCTCAAGAAAGTCATCCGGCACAAGCGACAGAGTGGGGTGAACGCCACCCTGCCAGAAGAGAACCAGCCAGTGGTGTTTAACCACGTTTACAACATCAAGCTGCCAGTGGGATCCCAGTGTTCGGTGGATCTGGAGTCAGCCAGTGGGGAGAAAGACCTGGCACCGCCTTCAGAGCCCAGCGAAAGCTTTCAGGAGCACACAGTGGATGGGGAAAACCAGATTGTCTTCACACATCGCATCAACATCCCCCGCCGGGCCTGTGGCTGTGCCGCAGCCCCTGATGTTAAGGAGCTGCTGAGCAGACTGGAGGAGCTGGAGAACCTGGTGTCTTCCCTGAGGGAGCAATGTACTGCAGGAGCAGGCTGCTGTCTCCAGCCTGCCACAGGCCGCTTGGACACCAGGCCCTTCTGTAGCGGTCGGGGCAACTTCAGCACTGAAGGATGTGGCTGTGTCTGCGAACCTGGCTGGAAAGGCCCCAACTGCTCTGAGCCCGAATGTCCAGGCAACTGTCACCTTCGAGGCCGGTGCATTGATGGGCAGTGCATCTGTGACGACGGCTTCACGGGCGAGGACTGCAGCCAGCTGGCTTGCCCCAGCGACTGCAATGACCAGGGCAAGTGCGTAAATGGAGTCTGCATCTGTTTCGAAGGCTACGCCGGGGCTGACTGCAGCCGTGAAATCTGCCCAGTGCCCTGCAGTGAGGAGCACGGCACATGTGTAGATGGCTTGTGTGTGTGCCACGATGGCTTTGCAGGCGATGACTGCAACAAGCCTCTGTGTCTCAACAATTGCTACAACCGTGGACGATGCGTGGAGAATGAGTGCGTGTGTGATGAGGGTTTCACGGGCGAAGACTGCAGTGAGCTCATCTGCCCCAATGACTGCTTCGACCGGGGCCGCTGCATCAATGGCACCTGCTACTGCGAAGAAGGCTTCACAGGTGAAGACTGCGGGAAACCCACCTGCCCACATGCCTGCCACACCCAGGGCCGGTGTGAGGAGGGGCAGTGTGTATGTGATGAGGGCTTTGCCGGTGTGGACTGCAGCGAGAAGAGGTGTCCTGCTGACTGTCACAATCGTGGCCGCTGTGTAGACGGGCGGTGTGAGTGTGATGATGGTTTCACTGGAGCTGACTGTGGGGAGCTCAAGTGTCCCAATGGCTGCAGTGGCCATGGCCGCTGTGTCAATGGGCAGTGTGTGTGTGATGAGGGCTATACTGGGGAGGACTGCAGCCAGCTACGGTGCCCCAATGACTGTCACAGTCGGGGCCGCTGTGTCGAGGGCAAATGTGTATGTGAGCAAGGCTTCAAGGGCTATGACTGCAGTGACATGAGCTGCCCTAATGACTGTCACCAGCACGGCCGCTGTGTGAATGGCATGTGTGTTTGTGATGACGGCTACACAGGGGAAGACTGCCGGGATCGCCAATGCCCCAGGGACTGCAGCAACAGGGGCCTCTGTGTGGACGGACAGTGCGTCTGTGAGGACGGCTTCACCGGCCCTGACTGTGCAGAACTCTCCTGTCCAAATGACTGCCATGGCCAGGGTCGCTGTGTGAATGGGCAGTGCGTGTGCCATGAAGGATTTATGGGCAAAGACTGCAAGGAGCAAAGATGTCCCAGTGACTGTCATGGCCAGGGCCGCTGCGTGGACGGCCAGTGCATCTGCCACGAGGGCTTCACAGGCCTGGACTGTGGCCAGCACTCCTGCCCCAGTGACTGCAACAACTTAGGACAATGCGTCTCGGGCCGCTGCATCTGCAACGAGGGCTACAGCGGAGAAGACTGCTCAGAGGTGTCTCCTCCCAAAGACCTCGTTGTGACAGAAGTGACGGAAGAGACGGTCAACCTGGCCTGGGACAATGAGATGCGGGTCACAGAGTACCTTGTCGTGTACACGCCCACCCACGAGGGTGGTCTGGAAATGCAGTTCCGTGTGCCTGGGGACCAGACGTCCACCATCATCCAGGAGCTGGAGCCTGGTGTGGAGTACTTTATCCGTGTATTTGCCATCCTGGAGAACAAGAAGAGCATTCCTGTCAGCGCCAGGGTGGCCACGTACTTACCTGCACCTGAAGGCCTGAAATTCAAGTCCATCAAGGAGACATCTGTGGAAGTGGAGTGGGATCCTCTAGACATTGCTTTTGAAACCTGGGAGATCATCTTCCGGAATATGAATAAAGAAGATGAGGGAGAGATCACCAAAAGCCTGAGGAGGCCAGAGACCTCTTACCGGCAAACTGGTCTAGCTCCTGGGCAAGAGTATGAGATATCTCTGCACATAGTGAAAAACAATACCCGGGGCCCTGGCCTGAAGAGGGTGACCACCACACGCTTGGATGCCCCCAGCCAGATCGAGGTGAAAGATGTCACAGACACCACTGCCTTGATCACCTGGTTCAAGCCCCTGGCTGAGATCGATGGCATTGAGCTGACCTACGGCATCAAAGACGTGCCAGGAGACCGTACCACCATCGATCTCACAGAGGACGAGAACCAGTACTCCATCGGGAACCTGAAGCCTGACACTGAGTACGAGGTGTCCCTCATCTCCCGCAGAGGTGACATGTCAAGCAACCCAGCCAAAGAGACCTTCACAACAGGCCTCGATGCTCCCAGGAATCTTCGACGTGTTTCCCAGACAGATAACAGCATCACCCTGGAATGGAGGAATGGCAAGGCAGCTATTGACAGTTACAGAATTAAGTATGCCCCCATCTCTGGAGGGGACCACGCTGAGGTTGATGTTCCAAAGAGCCAACAAGCCACAACCAAAACCACACTCACAGGTCTGAGGCCGGGAACTGAATATGGGATTGGAGTTTCTGCTGTGAAGGAAGACAAGGAGAGCAATCCAGCGACCATCAACGCAGCCACAGAGTTGGACACGCCCAAGGACCTTCAGGTTTCTGAAACTGCAGAGACCAGCCTGACCCTGCTCTGGAAGACACCGTTGGCCAAATTTGACCGCTACCGCCTCAATTACAGTCTCCCCACAGGCCAGTGGGTGGGAGTGCAGCTTCCAAGAAACACCACTTCCTATGTCCTGAGAGGCCTGGAACCAGGACAGGAGTACAATGTCCTCCTGACAGCCGAGAAAGGCAGACACAAGAGCAAGCCCGCACGTGTGAAGGCATCCACTGCCATGGGCTCCCCAAAGGAAGTCATTTTCTCAGACATCACTGAAAATTCGGCTACTGTCAGCTGGAGGGCACCCACAGCCCAAGTGGAGAGCTTCCGGATTACCTATGTGCCCATTACAGGAGGTACACCCTCCATGGTAACTGTGGACGGAACCAAGACTCAGACCAGGCTGGTGAAACTCATACCTGGCGTGGAGTACCTTGTCAGCATCATCGCCATGAAGGGCTTTGAGGAAAGTGAACCTGTCTCAGGGTCATTCACCACAGCTCTGGATGGCCCATCTGGCCTGGTGACAGCCAACATCACTGACTCAGAAGCCTTGGCCAGGTGGCAGCCAGCCATTGCCACTGTGGACAGTTATGTCATCTCCTACACAGGCGAGAAAGTGCCAGAAATTACACGCACGGTGTCCGGGAACACAGTGGAGTATGCTCTGACCGACCTCGAGCCTGCCACGGAATACACACTGAGAATCTTTGCAGAGAAAGGGCCCCAGAAGAGCTCAACCATCACTGCCAAGTTCACAACAGACCTCGATTCTCCAAGAGACTTGACTGCTACTGAGGTTCAGTCGGAAACTGCCCTCCTTACCTGGCGACCCCCCCGGGCATCAGTCACCGGTTACCTGCTGGTCTATGAATCAGTGGATGGCACAGTCAAGGAAGTCATTGTGGGTCCAGATACCACCTCCTACAGCCTGGCAGACCTGAGCCCATCCACCCACTACACAGCCAAGATCCAGGCACTCAATGGGCCCCTGAGGAGCAATATGATCCAGACCATCTTCACCACAATTGGACTCCTGTACCCCTTCCCCAAGGACTGCTCCCAAGCAATGCTGAATGGAGACACGACCTCTGGCCTCTACACCATTTATCTGAATGGTGATAAGGCTGAGGCGCTGGAAGTCTTCTGTGACATGACCTCTGATGGGGGTGGATGGATTGTGTTCCTGAGACGCAAAAACGGACGCGAGAACTTCTACCAAAACTGGAAGGCATATGCTGCTGGATTTGGGGACCGCAGAGAAGAATTCTGGCTTGGGCTGGACAACCTGAACAAAATCACAGCCCAGGGGCAGTACGAGCTCCGGGTGGACCTGCGGGACCATGGGGAGACAGCCTTTGCTGTCTATGACAAGTTCAGCGTGGGAGATGCCAAGACTCGCTACAAGCTGAAGGTGGAGGGGTACAGTGGGACAGCAGGTGACTCCATGGCCTACCACAATGGCAGATCCTTCTCCACCTTTGACAAGGACACAGATTCAGCCATCACCAACTGTGCTCTGTCCTACAAAGGGGCTTTCTGGTACAGGAACTGTCACCGTGTCAACCTGATGGGGAGATATGGGGACAATAACCACAGTCAGGGCGTTAACTGGTTCCACTGGAAGGGCCACGAACACTCAATCCAGTTTGCTGAGATGAAGCTGAGACCAAGCAACTTCAGAAATCTTGAAGGCAGGCGCAAACGGGCATAAATTCCAGGGACCACTGGGTGAGAGAGGAATAAGGCCCAGAGCGAGGAAAGGATTTTACCAAAGCATCAATACAACCAGCCCAACCATCGGTCCACACCTGGGCATTTGGTGAGAGTCAAAGCTGACCATGGATCCCTGGGGCCAACGGCAACAGCATGGGCCTCACCTCCTCTGTGATTTCTTTCTTTGCACCAAAGACATCAGTCTCCAACATGTTTCTGTTTTGTTGTTTGATTCAGCAAAAATCTCCCAGTGACAACATCGCAATAGTTTTTTACTTCTCTTAGGTGGCTCTGGGAATGGGAGAGGGGTAGGATGTACAGGGGTAGTTTGTTTTAGAACCAGCCGTATTTTACATGAAGCTGTATAATTAATTGTCATTATTTTTGTTAGCAAAGATTAAATGTGTCATTGGAAGCCATCCCTTTTTTTACATTTCATACAACAGAAACCAGAAAAGCAATACTGTTTCCATTTTAAGGATATGATTAATATTATTAATATAATAATGATGATGATGATGATGAAAACTAAGGATTTTTCAAGAGATCTTTCTTTCCAAAACATTTCTGGACAGTACCTGATTGTATTTTTTTTTTAAATAAAAGCACAAGTACTTTTGAGTTTGTTA