Transcript asmbl_143559

Sequence
Transcript Sequence for observation asmbl_143559 of TGE0056108:
AGAAAGAATGCTGGCAAAGATCTCTACCACATGGAAACTGTTCTTAAAGCTGCTGGGCCCTGAAATTTTACTCAGCAGTTTGAAATCAAGACATAGCTTTTCTCATTCACCCTCCCACTTGGGGCTAATGCACAGACATGAACATCTATTGAGGAAAACCACAAAAAACTTCAAAACAGCTACAACGGGAAAAAGAGAGTTTTGTCCCACAGTCAGCAGGCCACTAGTTTATTAACTTCCAGTCACCTTGATTTTTGCTAAAATGAAGACTCTGCAGTCTACACTTCTCCTGTTACTGCTTGTGCCTCTGATAAAGCCAGCACCACCAACCCAGCAGGACTCACGCATTATCTATGATTATGGAACAGATAATTTTGAAGAATCCATATTTAGCCAAGATTATGAGGATAAATACCTGGATGGAAAAAATATTAAGGAAAAAGAAACTGTGATAATACCCAATGAGAAAAGTCTTCAATTACAAAAAGATGAGGCAATAACACCATTACCTCCCAAGAAAGAAAATGATGAAATGCCCACGTGTCTGCTGTGTGTTTGTTTAAGTGGCTCTGTATACTGTGAAGAAGTTGACATTGATGCTGTACCACCCTTACCAAAGGAATCAGCCTATCTTTACGCACGATTCAACAAAATTAAAAAGCTGACTGCCAAAGATTTTGCAGACATACCTAACTTAAGAAGACTCGATTTTACAGGAAATTTGATAGAAGATATAGAAGATGGTACTTTTTCAAAACTTTCTCTGTTAGAAGAACTTTCACTTGCTGAAAATCAACTACTAAAACTTCCAGTTCTTCCTCCCAAGCTCACTTTATTTAATGCAAAATACAACAAAATCAAGAGTAGGGGAATCAAAGCAAATGCATTCAAAAAACTGAATAACCTCACCTTCCTCTACTTGGACCATAATGCCCTGGAATCCGTGCCTCTTAATTTACCAGAAAGTCTACGTGTAATTCATCTTCAGTTCAACAACATAGCTTCAATTACAGATGACACATTCTGCAAGGCTAATGACACCAGTTACATCCGGGACCGCATTGAAGAGATACGCCTGGAGGGCAATCCAATCGTCCTGGGAAAGCATCCAAACAGTTTTATTTGCTTAAAAAGATTACCGATAGGGTCATACTTTTAACCTCTATTGGTACAACATATAAATGAAAGTACACCTACACTAATAGTCTGTCTCAACAATGAGTAAAGGAACTTAAGTATTGGTTTAATATTAACCTTGTATCTCATTTTGAAGGAATTTAATATTTTAAGCAAGGATGTTCAAAATCTTACATATAATAAGTAAAAAGTAAGACTGAATGTCTACGTTCGAAACAAAGTAATATGAAAATATTTAAACAGCATTACAAAATCCTAGTTTATACTAGACTACCATTTAAAAATCATGTTTTTATATAAATGCCCAAATTTGAGATGCATTATTCCTATTACTAATGATGTAAGTACGAGGATAAATCCAAGAAACTTTCAACTCTTTGCCTTTCCTGGCCTTTACTGGATCCCAAAAGCATTTAAGGTACATGTTCCAAAAACTTTGAAAAGCTAAATGTTTCCCATGATCGCTCATTCTTCTTTTATGATTCATACGTTATTCCTTATAAAGTAAGAACTTTGTTTTCCTCCTATCAAGGCAGCTATTTTATTAAATTTTTCACTTAGTCTGAGAAATAGCAGATAGTCTCATATTTAGGAAAACTTTCCAAATAAAATAAATGTTATTCTCTGATAAAGAGCTAATACAGAAATGTTCAAGTTATTTTACTTTCTGGTAATGTCTTCAGTAAAATATTTTCTTTATCTAAATATTAACATTCTAAGTCTACCAAAAAAAGTTTTAAACTCAAGCAGGCCAAAACCAATATGCTTATAAGAAATAATGAAAAGTTCATCCATTTCTGATAAAGTTCTCTATGGCAAAGTCTTTCAAATACGAGATAACTGCAAAATATTTTCCTTTTATACTACAGAAATGAGAATCTCATCAATAAATTAGTTCAAGCATAAGATGAAAACAGAATATTCTGTGGTGCCAGTGCACACTACCTTCCCACCCATACACATCCATGTTCACTGTAACAAACTGAATATTCACAATAAAGCTTCTGAGTAACACTTTCTGATTACTCATGATAAACTGACATGGCTAACTGCAAGAATTAAATCTTCTATCTGAGAGTAATAATTTATGATGACTCAGTGGTGCCAGAGTAAAGTTTCTAAAATAACATTCCTCTCACTTGTACCCCACTAAAAGTATTAGACTACACATTACATTGAAGTTAAACACAAAATTATCAGTGTTTTAGAAACATGAGTCCGGACTGTGTAAGTAAAAGTACAAACATTATTTCCACCATAAAGTATGTATTGAAATCAAGTTGTCTCTGTGTACAGAATACATACTTATTCCCATTTTTAAGCATTTGCTTCTGTTTTCCCTACCTAGAATGTCAGATGTTTTTCAGTTATCTCCCCATTTGTCAAAGTTGACCTCAAGATAACATTTTTCATTAAAGCATCTGAGATCTAAGAACACAATTATTATTCTAACAATGATTATTAGCTCATTCACTTATTTTGATAACTAATGATCACAGCTATTATACTACTTTCTCGTTATTTTGTGTGCATGCCTCATTTCCCTGACTTAAACCTCACTGAGAGCGCAAAATGCAGCTTTATACTTTTTACTTTCAATTGCCTAGCACAATAGTGAGTACATTTGAATTGAATATATAATAAATATTGCAAAATAAAATCCATCTAAATAGAAGGGTTCTGTTTTATTTGGAAAAATTGAATCTTTAAACTATCATAATCTTGAATGACTGTCATCTTTCTAGTTTTCAGAAAAATAATGTATTCCTATATTATTTTTATGATAAAACTTATGGAGCAAAACACCATCAAATAACTCTCAAATTAAGAAAAAATTCAAAAGTCAGTAGTTTTAGATAAGATAATGATAAGGGAGAAAGAACATTGGTAAAAGGTATGAATTCCAGAATTAAAGAAATAATTTGGGGATTTCTAGATAAGAGGATATATATGAACATGCATACCTTACACCTTCATATACACAACCTTAAATCACAAATAAAACAAAATAAACAATACAAATTATACCACCAAGATTCAGAAGATATCAGACGAAATAATTAGAGAAAGTAAAAATATGCTGTCTCCATTATATTCATAATGTTTCATTCTTGACACTAATAATTAGAGGCTTTAAATTTTTAAATGATTTACTTTTTACTAACATTGCTGAAAAAAACTAAAGACATACATAAATGGAAAGATGTCTTGTGTTTATGGATGGTAAGATTTAATGTTGTTAAGACAACAATACTATCCAATATGATATGCAGACTGAACACAGTTGCCATCAAAATCTCAATGATGCTTTCACACAAATAAAATGGAACTTCAAGAGACCCCCAAATAAAGAGAAGAATCTTGAAAATAAGAATAAAGATAGAAGACTCACATTTCCTAACTTCAACATTTACAACAAAGATACAGTAATGAAAACAGTGTGTGGCTGGGCGCAATGGCTCACACCTGTAATCCCACTACTTGGGAGGCTGAGGCAGGAGAATCGCTT