Transcript asmbl_143384

Sequence
Transcript Sequence for observation asmbl_143384 of TGE0003009:
GAAGAGGCTTGGGTGCAGCGCCACGTCCCAGGGGCTATGCAAATGTAGGGGACGGCCCTGCTGCCGCCTCGCACCCCGAGGGCGGGGGTTCCGGGGCTCCGGCTCCGCCTTCTACCCCAAGCTAGAAAAAGGAAGAGTTCTAGCCTGAAAGGGAACTCGGGCGTCGTCCTGGCGTCCTCTCCGGATTGCGCCGCACCCTCGCTTCCTGCCAGGGAGGGGCTGCCGGGCTTTGGCGGCTCCCGAGCATCGAGAACGGGGCCAGAGCAGCTTCCTGCCTGCCCCCCGCGACCATAGAGCGCGGGCCCAGGGCGCCGCCCGCGGGTGGGGGACGTTCCCAGGACGGAAGTGGCCGAGAGAGTGTCGAAGGGAGGGCGAGGCCGGAGCCCGAGGGCGACCCGAGAAGCGGCGGGGCGGCGGGCCGGCGGGCGGGGCGCAGAGCCAGGCAGCGCAGGTATAGCCAGGCTGGAGAAAAGAAGCTGCCACCATGGTTGCACTTTCACTGAAGATCAGCATTGGGAATGTGGTGAAGACGATGCAGTTTGAGCCGTCTACCATGGTGTACGACGCCTGCCGCATCATTCGTGAGCGGATCCCAGAGGCCCCAGCTGGTCCTCCCAGCGACTTTGGGCTCTTTCTGTCAGATGATGACCCCAAAAAGGGTATATGGCTGGAGGCTGGGAAAGCTTTGGACTACTACATGCTCCGAAATGGGGACACTATGGAGTACAGGAAGAAACAGAGACCCCTGAAGATCCGTATGCTGGATGGAACTGTGAAGACGATCATGGTGGATGACTCTAAGACTGTCACTGACATGCTCATGACCATCTGTGCCCGCATTGGCATCACCAATCATGATGAATATTCATTGGTTCGAGAGCTGATGGAAGAGAAAAAGGAGGAAATAACAGGGACCTTAAGAAAGGACAAGACATTGCTGCGAGATGAAAAGAAGATGGAGAAACTAAAGCAGAAATTGCACACAGATGATGAGTTGAACTGGCTGGACCATGGTCGGACACTGAGGGAGCAGGGTGTAGAGGAGCACGAGACGCTGCTGCTGCGGAGGAAGTTCTTTTACTCAGACCAGAATGTGGATTCCCGGGACCCTGTACAGCTGAACCTCCTGTATGTGCAGGCACGAGATGACATCCTGAATGGCTCCCACCCTGTCTCCTTTGACAAGGCCTGTGAGTTTGCTGGCTTCCAATGCCAGATCCAGTTTGGGCCCCACAATGAGCAGAAGCACAAGGCTGGCTTCCTTGACCTGAAGGACTTCCTGCCCAAGGAGTATGTGAAGCAGAAGGGAGAGCGTAAGATCTTCCAGGCACACAAGAATTGTGGGCAGATGAGTGAGATTGAGGCCAAGGTCCGCTACGTGAAGCTAGCCCGTTCTCTCAAGACTTACGGTGTCTCCTTCTTCCTGGTGAAGGAAAAAATGAAAGGGAAGAACAAGCTAGTGCCCAGGCTTCTGGGCATCACCAAGGAGTGTGTGATGCGAGTGGATGAGAAGACCAAGGAAGTGATCCAGGAGTGGAACCTCACCAACATCAAACGCTGGGCTGCGTCTCCCAAAAGCTTCACCCTGGATTTTGGAGATTACCAAGATGGCTATTACTCAGTACAGACAACTGAAGGGGAGCAGATTGCACAGCTCATTGCCGGCTACATCGATATCATCCTGAAGAAGAAAAAAAGCAAGGATCACTTTGGGCTGGAAGGAGATGAGGAGTCTACTATGCTGGAGGACTCAGTGTCCCCCAAAAAGTCAACAGTCCTGCAGCAGCAATACAACCGGGTGGGGAAAGTGGAGCATGGCTCTGTGGCCCTGCCTGCCATCATGCGCTCTGGAGCCTCTGGTCCTGAGAATTTCCAGGTGGGCAGCATGCCCCCTGCCCAGCAGCAGATTACCAGCGGCCAGATGCACCGAGGACACATGCCTCCTCTGACTTCAGCCCAGCAGGCACTCACTGGAACCATTAACTCCAGCATGCAGGCCGTGCAGGCTGCCCAGGCCACCCTGGATGACTTTGACACTCTGCCGCCTCTTGGCCAGGATGCTGCCTCTAAGGCCTGGCGTAAAAACAAGATGGATGAATCAAAGCATGAGATCCACTCTCAGGTAGATGCCATCACAGCTGGTACTGCGTCTGTGGTGAACCTGACAGCAGGGGACCCTGCTGAGACAGACTATACCGCAGTGGGCTGTGCAGTCACCACAATCTCCTCCAACCTGACGGAGATGTCCCGTGGGGTGAAGCTGCTGGCTGCCTTGCTGGAGGACGAAGGCGGCAGTGGTCGGCCCCTGTTGCAGGCAGCAAAGGGCCTTGCGGGAGCAGTGTCAGAACTGCTGCGCAGTGCCCAACCAGCCAGTGCTGAGCCCCGTCAGAACCTGCTGCAAGCAGCTGGGAACGTGGGCCAGGCCAGTGGGGAGCTGTTGCAACAAATTGGGGAAAGTGATACTGACCCCCACTTCCAGGATGCGCTAATGCAGCTCGCCAAAGCTGTGGCAAGTGCTGCAGCTGCCCTGGTCCTCAAGGCCAAGAGTGTGGCCCAGCGGACAGAGGACTCGGGACTTCAGACCCAAGTTATTGCTGCAGCAACACAGTGTGCCCTATCCACTTCCCAACTAGTGGCCTGTACTAAGGTGGTGGCACCTACAATCAGCTCACCTGTCTGCCAAGAGCAACTGGTGGAGGCTGGACGACTGGTAGCCAAAGCCGTGGAGGGCTGTGTGTCTGCCTCCCAGGCAGCTACAGAGGATGGGCAACTGTTGCGAGGGGTAGGAGCAGCAGCCACAGCTGTCACCCAGGCCCTAAATGAGCTGCTGCAGCATGTGAAAGCCCATGCCACAGGGGCTGGGCCTGCTGGCCGTTATGACCAGGCTACTGACACCATCCTAACCGTCACTGAGAACATCTTTAGCTCCATGGGTGATGCTGGGGAGATGGTGCGACAGGCCCGCATCCTGGCCCAAGCCACATCTGACCTGGTCAATGCCATCAAGGCTGATGCTGAGGGGGAAAGTGATCTGGAGAACTCCCGCAAGCTCTTAAGTGCTGCCAAGATCCTAGCTGATGCCACAGCCAAGATGGTAGAGGCTGCCAAGGGAGCAGCTGCCCACCCTGACAGTGAGGAGCAGCAGCAGCGGCTGCGGGAGGCAGCTGAGGGGCTGCGCATGGCCACCAATGCAGCTGCGCAGAATGCCATCAAGAAAAAGCTGGTGCAGCGCCTGGAGCATGCAGCCAAGCAGGCTGCAGCCTCAGCCACACAGACCATCGCTGCAGCTCAGCACGCAGCCTCTACCCCCAAGGCCTCTGCCGGCCCCCAGCCCCTGCTGGTGCAGAGCTGCAAGGCAGTGGCAGAGCAGATTCCACTGCTGGTGCAGGGCGTCCGAGGAAGCCAAGCCCAGCCTGACAGCCCCAGCGCTCAGCTTGCCCTCATTGCTGCCAGCCAGAGCTTCCTGCAGCCAGGTGGGAAGATGGTGGCAGCTGCAAAGGCCTCAGTGCCAACGATTCAGGACCAGGCTTCAGCCATGCAGCTGAGTCAGTGTGCCAAGAACCTGGGCACCGCGCTGGCTGAACTCCGGACGGCTGCCCAGAAGGCTCAGGAAGCATGTGGACCTTTGGAGATGGATTCTGCACTGAGTGTGGTACAGAATCTAGAGAAAGATCTACAGGAAGTGAAGGCAGCAGCTCGAGATGGCAAGCTTAAACCCTTACCTGGGGAGACAATGGAGAAGTGTACCCAGGACCTGGGCAACAGCACCAAAGCCGTGAGCTCAGCCATCGCCCAGCTACTGGGAGAGGTTGCCCAGGGCAATGAGAATTATGCAGGTATTGCAGCTCGGGATGTGGCAGGTGGGCTGCGGTCACTGGCCCAGGCCGCTAGGGGAGTCGCTGCACTGACGTCAGATCCTGCAGTGCAGGCCATTGTACTTGATACGGCCAGTGATGTGCTGGACAAGGCCAGCAGCCTCATTGAGGAGGCGAAAAAGGCAGCTGGCCATCCAGGGGACCCTGAGAGCCAGCAGCGGCTTGCCCAGGTGGCTAAAGCAGTGACCCAGGCTCTGAACCGCTGTGTCAGCTGCCTACCTGGCCAGCGCGATGTGGATAATGCCCTGAGGGCAGTTGGAGATGCCAGCAAGCGACTCCTGAGTGACTCGCTTCCTCCTAGCACTGGGACATTTCAAGAAGCTCAGAGCCGGTTGAATGAAGCTGCTGCTGGGCTGAATCAGGCAGCCACAGAACTGGTGCAGGCCTCTCGGGGAACCCCTCAGGACCTGGCTCGAGCCTCAGGCCGATTTGGACAGGACTTCAGCACCTTCCTGGAAGCTGGTGTGGAGATGGCAGGCCAGGCTCCGAGCCAGGAGGACCGAGCCCAAGTTGTGTCCAACTTGAAGGGCATCTCCATGTCTTCAAGCAAACTTCTTCTGGCTGCCAAGGCCCTGTCCACGGACCCTGCTGCCCCTAACCTCAAGAGTCAGCTGGCTGCAGCTGCCAGGGCAGTAACTGACAGCATCAATCAGCTCATCACTATGTGCACCCAGCAGGCACCCGGCCAGAAGGAGTGTGATAACGCCCTGCGGGAATTGGAGACGGTCCGGGAACTCCTGGAGAACCCAGTCCAGCCCATCAATGACATGTCCTACTTTGGTTGCCTGGACAGTGTAATGGAGAACTCAAAGGTGCTGGGCGAGGCCATGACTGGCATCTCCCAAAATGCCAAGAACGGAAACCTGCCAGAGTTTGGAGATGCCATTTCCACAGCCTCAAAGGCACTTTGTGGCTTCACCGAGGCAGCTGCACAGGCTGCATATCTGGTTGGTGTCTCTGACCCCAATAGCCAAGCTGGACAGCAAGGGCTAGTGGAGCCCACACAGTTTGCCCGTGCAAACCAGGCAATTCAGATGGCCTGCCAGAGTTTGGGAGAGCCTGGCTGTACCCAGGCCCAGGTGCTCTCTGCAGCCACCATTGTGGCTAAACACACCTCTGCACTGTGTAACAGCTGTCGCCTGGCTTCTGCCCGTACCACCAATCCTACTGCCAAGCGCCAGTTTGTACAGTCAGCCAAGGAGGTGGCCAACAGCACAGCTAATCTTGTCAAGACCATCAAGGCGCTAGATGGGGCCTTCACAGAGGAGAACCGTGCCCAGTGCCGAGCAGCAACAGCCCCTCTGCTGGAGGCTGTGGACAATCTGAGTGCCTTTGCGTCCAACCCTGAGTTCTCCAGCATTCCTGCCCAGATCAGCCCTGAGGGTCGGGCTGCCATGGAGCCCATTGTGATCTCTGCCAAGACAATGTTAGAGAGTGCCGGGGGACTCATCCAGACAGCCCGGGCCCTCGCAGTCAATCCCCGGGACCCCCCGAGCTGGTCGGTGCTGGCCGGCCACTCCCGTACTGTCTCAGACTCCATCAAGAAGCTAATTACAAGCATGAGGGACAAGGCTCCAGGGCAGCTGGAGTGTGAAACGGCCATTGCAGCTCTGAACAGTTGTCTACGGGACCTAGACCAGGCTTCCCTCGCTGCAGTCAGCCAGCAGCTTGCTCCCCGTGAGGGAATCTCTCAAGAGGCCTTGCACACTCAGATGCTCACTGCAGTCCAAGAGATCTCCCATCTCATTGAGCCGCTGGCCAATGCTGCCCGGGCTGAAGCCTCCCAGCTGGGACACAAGGTGTCCCAGATGGCGCAGTACTTTGAGCCGCTCACCCTGGCTGCAGTGGGTGCTGCCTCCAAGACCCTGAGCCACCCGCAGCAGATGGCACTCCTGGACCAGACTAAAACATTGGCAGAGTCTGCCCTGCAGTTGCTATACACTGCCAAGGAGGCTGGTGGTAACCCAAAGCAAGCAGCTCACACCCAGGAAGCCCTGGAGGAGGCTGTGCAGATGATGACCGAGGCCGTAGAGGACCTGACAACAACCCTCAACGAGGCAGCCAGTGCTGCTGGGGTCGTGGGTGGCATGGTGGACTCCATCACCCAGGCCATCAACCAGCTAGATGAAGGACCAATGGGTGAACCAGAAGGTTCCTTCGTGGATTACCAAACAACTATGGTGCGGACAGCCAAGGCCATTGCAGTGACCGTTCAGGAGATGGTTACCAAGTCAAACACCAGCCCAGAGGAGCTGGGCCCTCTTGCTAACCAGCTGACCAGTGACTATGGCCGTCTGGCCTCGGAGGCCAAGCCTGCAGCGGTGGCTGCTGAAAATGAAGAGATAGGTTCCCATATCAAACACCGGGTACAGGAGCTGGGCCATGGCTGTGCCGCTCTGGTCACCAAGGCAGGCGCCCTGCAGTGCAGCCCCAGTGATGCCTACACCAAGAAGGAGCTCATAGAGTGTGCCCGGAGAGTCTCTGAGAAGGTCTCCCACGTCCTGGCTGCGCTCCAGGCTGGGAATCGTGGCACCCAGGCCTGCATCACAGCAGCCAGCGCTGTGTCTGGTATCATTGCTGACCTCGACACCACCATCATGTTCGCCACTGCTGGCACGCTCAATCGTGAGGGTACTGAAACTTTCGCTGACCACCGGGAGGGCATCCTGAAGACTGCGAAGGTGCTGGTGGAGGACACCAAGGTCCTGGTGCAAAACGCAGCTGGGAGCCAGGAGAAGTTGGCGCAGGCTGCCCAGTCCTCCGTGGCGACCATCACCCGCCTCGCTGATGTGGTCAAGCTGGGTGCAGCCAGCCTGGGAGCTGAGGACCCTGAGACCCAGGTGGTACTAATCAACGCAGTGAAAGATGTAGCCAAAGCCCTGGGAGACCTCATCAGTGCAACGAAGGCTGCAGCTGGCAAAGTTGGAGATGACCCTGCTGTGTGGCAGCTAAAGAACTCTGCCAAGGTGATGGTGACCAATGTGACATCATTGCTTAAGACAGTAAAAGCCGTGGAAGATGAGGCCACCAAAGGCACTCGGGCCCTGGAGGCAACCACAGAACACATACGGCAGGAGCTGGCGGTTTTCTGTTCCCCAGAGCCACCTGCCAAGACCTCTACCCCAGAAGACTTCATCCGAATGACCAAGGGTATCACCATGGCAACCGCCAAGGCCGTTGCTGCTGGCAATTCCTGTCGCCAGGAAGATGTCATTGCCACAGCCAATCTGAGCCGCCGTGCTATTGCAGATATGCTTCGGGCTTGCAAGGAAGCAGCTTACCACCCAGAAGTGGCCCCTGATGTGCGGCTTCGAGCCCTGCACTATGGCCGGGAGTGTGCCAATGGCTACCTGGAACTGCTGGACCATGTACTGCTGACCCTGCAGAAGCCAAGCCCAGAACTGAAGCAGCAGTTGACAGGACATTCAAAGCGTGTGGCTGGTTCCGTCACTGAGCTCATCCAGGCTGCTGAAGCCATGAAGGGAACAGAATGGGTAGACCCAGAGGACCCCACAGTCATTGCTGAGAATGAGCTCCTGGGAGCTGCAGCCGCCATTGAGGCTGCAGCCAAAAAGCTAGAGCAGCTGAAGCCCCGGGCCAAACCCAAGGAGGCAGATGAGTCCTTGAACTTTGAGGAGCAGATACTAGAAGCTGCCAAGTCCATTGCAGCAGCCACCAGTGCACTGGTAAAGGCTGCGTCGGCTGCCCAGAGAGAACTAGTGGCCCAAGGGAAGGTGGGTGCCATTCCAGCCAATGCACTGGACGATGGGCAGTGGTCCCAGGGCCTCATTTCTGCTGCCCGGATGGTGGCTGCGGCCACCAACAATCTGTGTGAGGCAGCCAATGCAGCTGTACAAGGCCATGCCAGCCAGGAGAAGCTCATCTCATCAGCCAAGCAGGTAGCTGCCTCCACAGCCCAGCTCCTTGTGGCCTGCAAGGTCAAGGCTGACCAGGACTCGGAGGCAATGAAACGACTTCAGGCTGCTGGCAACGCAGTGAAGCGAGCCTCAGATAATCTGGTGAAAGCAGCACAGAAGGCTGCAGCCTTTGAAGAGCAGGAGAATGAGACAGTGGTGGTGAAAGAGAAGATGGTTGGCGGCATTGCCCAGATCATCGCAGCACAGGAAGAAATGCTTCGGAAGGAACGAGAGCTGGAAGAGGCGCGGAAGAAACTGGCCCAGATCCGGCAGCAGCAGTACAAGTTTCTGCCTTCAGAGCTTCGAGATGAGCACTAAAGAAGCCTCTTCTATTTAATGCAGACCCGGCCCAGAGACTGTGCGTGCCACTACCAAAGCCTTCTGGGCTGTCGGGGCCCAACCTGCCCAACCCCAGCACTCCCCAAAGTGCCTGCCAAACCCCAGGGCCTGGCCCCGCCCAGTCCCGCAGTACATCCCCTGTCCCCTCCCCAACCCCAAGTGCCTTCATGCCCTAGGGCCCCCCAAGTGCCTGCCCCTCCCCAGAGTATTAACGCTCCAAGAGTATTATTAACGCTGCTGTACCTCGATCTGAATCTGCCGGGGCCCCAGCCCACTCCACCCTGCCAGCAGCTTCCGGCCAGTCCCCACAGCCTCATCAGCTCTCTTCACCGTTTTTTGATACTATCTTCCCCCACCCCCAGCTACCCATAGGGGCTGCAGAGTTATAAGCCCCAAACAGGTCATGCTCCAATAAAAATGATTCTACCTACAACCTCTGCCTGGCTTCAAGGGAGATACAAGTTTTCTCCCAGGGCAGTAGGAGAGACAGTGGGGTTGAATTCTGTCACCCAGCTTGATCCAGCTTGAAATGGGAGAGGGGAAGACTGGCAGTCTGCACCTGAGGTCCCTTCCTCCTTGCACCCGGACCCTAAAGTTATCCAATGGGGAAGTTGTGCCTGAGAAGTCATACTCCTGTTATCCTCACCTCCCTGGCCAGCACCTAAGCCTCACAAAGTGTCGTTCTGCTGCTGCTGGGACAGCAGCTACCACAGTTCCTTGTGGCTACCAGGACATTCTGTTCTTCATAGCTACTCAGGGTATGTCAACAAATCCAGTCCTTGACCAAATTCAAATTTTCAAAAGAAGCTTTGCTAAAAATAATATGCCTGTAAGTGTCTGAGCCTAAGAGAACTATGGCCACAAAACTGATTGAAGCCATTAGCAAGCAGAAAAATCCCAACTTGAGGCTGCCTCGGGTAGGCACCGCTCTTGATTGGGTTGGGACACTCCTGCCTAGGGTAGCGCTAAAAGTGAAGAGCTTGACCCAGGTGTGAGAATTTATTGTTAGAGGGGGCAGAGCTCCCCTAGTGGCCAGGAAGGTGCTAGCAGCCCTGTTCCAGCCACCCTGCTTATCTGGTGGGTCAGTGGAAAGAGGCAGTCAGAGAGGTGGATGCTGTGTGCTTCCACGTCCCCATCCAGCCACTCTGTCCATAATGCATGGACTCTCTGACAGTCGTCTTAGGTTGGCAACTATTTTCATGCGTGATTCTTTAGTCAGCCCTACCGCCCAGTACATTATTTCCTCAAGTAGAACACAAACGCCACCCATCTGCTACTAACACCTTCTACTCCCACCACATTAGGGAAAGCTTGAAGTAGATGGAATGTAGCTGGTAACGGTGGTTCGAGCCTCTAATCCCAGCTACTTAAAAGGCTGAGGCAGGAGGACTGCTTGAGACCAGGAGTTCAAGACCAGCCTAGCTAACACAGTGAAACCCCGTCTCTACTAAAAATATAAAAAGTTATCTGGGCATGGTGG