Transcript asmbl_143379

Sequence
Transcript Sequence for observation asmbl_143379 of TGE0058120:
CATGAAGGATGAGGAGAAGATGGAACTGCAGGAGATGCAGCTGAAGGAGGCCAAGCACATCGCTGAGGATTCAGACCGCAAATATGAAGAGGTGGCCAGGAAGCTGGTGATCCTGGAAGGAGAGCTGGAGCGCTCGGAGGAGAGGGCTGAGGTGGCCGAGAGCCGAGCCAGACAGCTGGAGGAGGAACTTCGAACCATGGACCAGGCCCTCAAGTCCCTGATGGCCTCAGAGGAGGAGGTAGTGACCCCTCTGAACCTTTCTGGGCAATGGCGCCTTCTCTCAGCTCACCTTCCCTCCGTCTCAGCACCGCAGGCTGCTCTTTCTCAGCTGCTGGGGATCAGGAAGGGCCTGGGGCTTCTGAGCCCTGCCTGCTGTCACTCTCACAACTTTGCTCTTCTCTTCTCTCCTCCACCCGTCCCCTGCTGTGCCATCTCCACTGTCTGGCTTCGCTGTGCCCTCACACCCTGCCCCCCCCGCCACACACCCCCTGCAGTAAATGTGGGGACCTAGAGGAGGAGCTGAAAATTGTTACCAACAACTTGAAATCCCTGGAGGCCCAGGCGGACAAGTATTCCACCAAAGAAGATAAATATGAAGAGGAGATCAAACTGTTGGAGGAGAAGCTGAAGGAGGCTGAGACCCGAGCAGAGTTTGCCGAGAGGTCTGTGGCAAAGTTGGAGAAAACCATCGATGACCTAGAAGAGACCTTGGCCAGTGCCAAGGAGGAGAACGTCGAGATTCACCAGACCTTGGACCAGACCCTGCTGGAACTCAACAACCTGTGAGGGCCAGCCCCACCCCCAGCCAGGCTATGGTTGCCACCCCAACCCAATAAAACTGATGTTACTAGCC