Transcript asmbl_143346

Sequence
Transcript Sequence for observation asmbl_143346 of TGE0003003:
GTTGCTGGGGAGAGGCGCGGAGAGGCGGGCGAGAGTCCGCAGGGCAGGCGCTGATTGGCTGAGGTGGGAGCAGCTTCCCTTCCGATGATTCGGCTCTTCTCGGCTCAGTCTCAGCGAAGCGTCTGCGACCGTCGTTTGAGTCGTCGCTGCCGCTGCCGCTGCCACTGCCACTGCCACCTCGCGGATCAGGAGCCAGCGTTGTTCGCCCGACGCCTCGCTGCCGGTGGGAGGAAGCGAGAGGGAAGCCGCTTGCGGGTTTGTCGCCGCTGCTCGCCCACCGCCTGGAAGAGCCGAGCCCCGGCCCAGTCGGTCGCTTGCCACCGCTCGTAGCCGTTACCCGCGGGCCGCCACAGCCGCCGGCCGGGAGAGGCGCGCGCCATGGCTTCTGGAGCCGATTCAAAAGGTGATGACCTATCAACAGCCATTCTCAAACAGAAGAACCGTCCCAATCGGTTAATTGTTGATGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAGAAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGATGAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATCCAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATGACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTTCCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGGTGGAAACAGATCCTAGCCCTTATTGCATTGTTGCTCCAGACACAGTGATCCACTGCGAAGGGGAGCCTATCAAACGAGAGGATGAGGAAGAGTCCTTGAATGAAGTAGGGTATGATGACATTGGTGGCTGCAGGAAGCAGCTAGCTCAGATAAAGGAGATGGTGGAACTGCCCCTGAGACATCCTGCCCTCTTTAAGGCAATTGGTGTGAAGCCTCCTAGAGGAATCCTGCTTTACGGACCTCCTGGAACAGGAAAGACCCTGATTGCTCGAGCTGTAGCAAATGAGACTGGAGCCTTCTTCTTCTTGATCAATGGTCCTGAGATCATGAGCAAATTGGCTGGTGAGTCTGAGAGCAACCTTCGTAAAGCCTTTGAGGAGGCTGAGAAGAATGCTCCTGCCATCATCTTCATTGATGAGCTAGATGCCATCGCTCCCAAAAGAGAGAAAACTCATGGCGAGGTGGAGCGGCGCATTGTATCACAGTTGTTGACCCTCATGGATGGCCTAAAGCAGAGGGCACATGTGATTGTTATGGCAGCAACCAACAGACCCAACAGCATTGACCCAGCTCTACGGCGATTTGGTCGCTTTGACAGGGAGGTAGATATTGGAATTCCTGATGCTACAGGACGCTTAGAGATTCTTCAGATCCATACCAAGAACATGAAGCTGGCAGATGATGTGGACCTGGAACAGGTAGCCAATGAGACTCACGGGCATGTGGGTGCTGACTTAGCAGCCCTGTGCTCAGAGGCTGCTCTGCAAGCCATCCGCAAGAAGATGGATCTCATTGACCTAGAGGATGAGACCATTGATGCCGAGGTCATGAACTCTCTAGCAGTTACTATGGATGACTTCCGGTGGGCCTTGAGCCAGAGTAACCCATCAGCACTGCGGGAAACCGTGGTAGAGGTGCCACAGGTAACCTGGGAAGACATCGGGGGCCTAGAGGATGTCAAACGTGAGCTACAGGAGCTGGTCCAGTATCCTGTGGAGCACCCAGACAAATTCCTGAAGTTTGGCATGACACCTTCCAAGGGAGTTCTGTTCTATGGACCTCCTGGCTGTGGGAAAACTTTGTTGGCCAAAGCCATTGCTAATGAATGCCAGGCCAACTTCATCTCCATCAAGGGTCCTGAGCTGCTCACCATGTGGTTTGGGGAGTCTGAGGCCAATGTCAGAGAAATCTTTGACAAGGCCCGCCAAGCTGCCCCCTGTGTGCTATTCTTTGATGAGCTGGATTCGATTGCCAAGGCTCGTGGAGGTAACATTGGAGATGGTGGTGGGGCTGCTGACCGAGTCATCAACCAGATCCTGACAGAAATGGATGGCATGTCCACAAAAAAAAATGTGTTCATCATTGGCGCTACCAACCGGCCTGACATCATTGATCCTGCCATCCTCAGACCTGGCCGTCTTGATCAGCTCATCTACATCCCACTTCCTGATGAGAAGTCCCGTGTTGCCATCCTCAAGGCTAACCTGCGCAAGTCCCCAGTTGCCAAGGATGTGGACTTGGAGTTCCTGGCTAAAATGACTAATGGCTTCTCTGGAGCTGACCTGACAGAGATTTGCCAGCGTGCTTGCAAGCTGGCCATCCGTGAATCCATCGAGAGTGAGATTAGGCGAGAACGAGAGAGGCAGACAAACCCATCAGCCATGGAGGTAGAAGAGGATGATCCAGTGCCTGAGATCCGTCGAGATCACTTTGAAGAAGCCATGCGCTTTGCGCGCCGTTCTGTCAGTGACAATGACATTCGGAAGTATGAGATGTTTGCCCAGACCCTTCAGCAGAGTCGGGGCTTTGGCAGCTTCAGATTCCCTTCAGGGAACCAGGGTGGAGCTGGCCCCAGTCAGGGCAGTGGAGGCGGCACAGGTGGCAGTGTATACACAGAAGACAATGATGATGACCTGTATGGCTAAGTGGTGGTGGCCAGCGTGCAGTGAGCTGGCCTGCCTGGACCTTGTTCCCTGGGGGTGGGGGCGCTTGCCCAGGAGAGGGACCAGGGGTGCGCCCACAGCCTGCTCCATTCTCCAGTCTGAACAGTTCAGCTACAGTCTGACTCTGGACAGGGGGTTTCTGTTGCAAAAATACAAAACAAAAGCGATAAAATAAAAGCGATTTTCATTTGGTAGGCGGAGAGTGAATTACCAACAGGGAATTGGGCCTTGGGCCTATGCCATTTCTGTTGTAGTTTGGGGCAGTGCAGGGGACCTGTGTGGGGTGTGAACCAAGGCACTACTGCCACCTGCCACAGTAAAGCATCTGCACTTGACTCAATGCTGCCCGAGCCCTCCCTTCCCCCTATCCAACCTGGGTAGGTGGGTAGGGGCCACAGTTGCTGGATGTTTATATAGAGAGTAGGTTGATTTATTTTACATGCTTTTGAGTTAATGTTGGAAAACTAATCACAAGCAGTTTCTAAACCAAAAAATGACATGTTGTAAAAGGACAATAAACGTTGGGTCAAAATGGAGCCTGAGTCCTGGGCCCTGTGCCTGCTTCTTTTCCTGGGAACAGCCTTGGGCTACCCACCACTCCCAAGGCATTCTTCCAAATGTGAAATCCTGGAAGTAAGATTGCACCTTCTTCCTCTCCTGATCAACATCGGTATGATGTCTCCTGTTGCCTCACCCTTTGTCTGCAGTATCACTGGATAGGACTGGTGGAAAGGGAGCAGCCTGACAGAGCTCCAAATGTGGAGAATATGGCATCCCTCCACCTATATTTGATGTGGACGGTAAGGCTAGGCCTGCAGGATCCCTTATCCTGACCAAAGACTGTGTTGGGGTGCCATTTGAAAATCGCAGGGTTGCAAAAGAATACAATCTTACTTGCAGGTGGATATTCTCTATACTCTCTTTTAATGCATCTAAAAATCCCAAACATCCCCTGGTTGGTGATCACTTACAGTTGTGTCCACCTTTATTTTATGTACTTTGATT