Transcript asmbl_14308

Sequence
Transcript Sequence for observation asmbl_14308 of TGE0059592:
AAGACGGGCACCCTCACCCAGAACCGCATGACCGTCGCCCACATGTGGTTCGACAACCAAATCCATGAGGCTGACACCACCGAAGATCAGTCTGGGGCCACTTTTGACAAACGATCCCCTACGTGGACGGCCCTGTCTCGAATTGCTGGTCTCTGCAACCGCGCCGTCTTCAAGGCAGGACAGGAGAACATCTCCGTGTCTAAGCGGGACACAGCTGGTGATGCCTCTGAGTCAGCTCTGCTCAAGTGCATTGAGCTCTCCTGTGGCTCAGTGAGGAAAATGAGAGACAGAAACCCCAAGGTGGCAGAGATTCCTTTCAACTCTACCAACAAGTACCAGCTGTCTATCCACGAGCGAGAAGACAGCCCCCAGAGCCACGTGCTGGTGATGAAGGGGGCCCCAGAGCGCATTCTGGACCGGTGCTCCACCATCCTGGTGCAGGGCAAGGAGATCCCGCTCGACAAGGAGATGCAAGATGCCTTTCAAAATGCCTACATGGAGCTGGGGGGACTTGGGGAGCGTGTGCTGGGATTCTGTCAACTGAATCTGCCATCTGGAAAGTTTCCTCGGGGCTTCAAATTCGACACGGATGAGCTGAACTTTCCCACGGAGAAGCTTTGCTTTGTGGGGCTCATGTCTATGATTGACCCTCCCCGGGCTGCTGTGCCAGATGCTGTGGGCAAGTGCCGAAGCGCAGGCATCAAGGTGATCATGGTAACCGGGGATCACCCTATCACAGCCAAGGCCATTGCCAAAGGCGTGGGCATCATATCAGAGGGTAACGAGACTGTGGAGGACATTGCAGCCCGGCTCAACATTCCCATGAGTCAAGTCAACCCCAGAGAAGCCAAGGCATGCGTGGTGCACGGCTCTGACCTGAAGGACATGACATCGGAGCAGCTCGATGAGATCCTCAAGAACCACACAGAGATCGTCTTTGCTCGAACGTCTCCCCAGCAGAAGCTCATCATTGTGGAGGGATGTCAGAGGCAGGGAGCCATTGTGGCCGTGACGGGTGACGGGGTGAACGACTCCCCTGCATTGAAGAAGGCTGACATTGGCATTGCCATGGGCATCTCTGGCTCTGACGTCTCTAAGCAGGCAGCCGACATGATCCTGCTGGATGACAACTTTGCCTCCATCGTCACGGGGGTGGAGGAGGGCCGCCTGATCTTTGACAACTTGAAGAAATCCATCGCCTACACCCTGACCAGCAACATCCCCGAGATCACCCCCTTCCTGCTGTTCATCATTGCCAACATCCCCCTACCTCTGGGCACTGTGACCATCCTTTGCATTGACCTGGGCACAGATATGGTCCCTGCCATCTCCTTGGCCTATGAGGCAGCTGAGAGTGATATCATGAAGCGGCAGCCACGAAACTCCCAGACGGACAAGCTGGTGAATGAGAGGCTCATCAGCATGGCCTACGGACAGATCGGGATGATCCAGGCACTGGGTGGCTTCTTCACCTACTTTGTGATCCTGGCAGAGAACGGTTTCCTGCCATCACGGCTACTGGGAATCCGCCTCGACTGGGATGACCGGACCATGAATGATCTGGAGGACAGCTATGGACAGGAGTGGACCTATGAGCAGCGGAAGGTGGTGGAGTTCACGTGCCACACGGCATTCTTTGCCAGCATCGTGGTGGTGCAGTGGGCTGACCTCATCATCTGCAAGACCCGCCGCAACTCAGTCTTCCAGCAGGGCATGAAGAACAAGATCCTGATTTTTGGGCTCCTGGAGGAGACGGCGTTGGCTGCCTTTCTCTCTTACTGCCCAGGCATGGGTGTAGCCCTCCGCATGTACCCGCTCAAAGTCACCTGGTGGTTCTGCGCCTTCCCCTACAGCCTCCTCATCTTCATCTATGATGAGGTCCGAAAGCTCATCCTGCGGCGGTATCCTGGTGGCTGGGTGGAGAAGGAGACATACTACTGACCCCATTGGAAGAAGAACCAGGCATGGAAAGATGGGGAGCTCTGGAGGTGTTGTGGGGATGGTGATGGAGAGGGATGGAAATAACGGGTGGCATTGGGTGGCAACATTTGGGGAGAGATAATGAGGCAACTCAGCAGGCTAAGTTGCGGGGTATATAAATTGGGGTGATGACCCCATAGACCTAACTGTGAACAATCAGATTAGACACTATGTGTTAGAGTCCCCCCGACCAGATCCTTTTCCATCCCACTCCACTATGTTGTCTATTTTTTCTGAGGAATTAAGGGTTACCCCACCCTGCCCACTCCCATCCCTTCAACCCCACTTCCTACTGTAATAGATCAGCATCCAAAAGCAGGAACCCATCTAAACCAGAAGGAAGCCCTCTCAGATCACCCCAGCCTCACTCCATTTCCCACTTCCACCCCCGTTAGCTTCCTGCAGGACTCTATCCCTGGCTTCCCCTTCAGACCTTGCAATCACAAAAGGTTCTTCTGGTGAGTGCAAGAGCCTGAGACTGGAAAAGGTGGACTTGTCTCCCAGTCGAGGCTGGTAAGGGACCTTCAGGGAGAGCTGGGCAGACAGGTGGGAGATGGAGGTAGGGCTGGCTGGAGGAAGGAAACAACAAAGGAAGTGAGGTAGTGCCAATGACAGGACATTTGACATGAGTCTCCAGATAGATGTCGTGGACTCCAGCTCTACGTCCCACATTTTAGAATACCCCACCAGCAGAACAAACTCAGATCTCATCAGGGTAGCAGCAGAGGCAGGACCAGAAGGCAATCAAGAGCTTCCAGAAATGCCACACTTGTGTGCCACAGAGTTCCCCGCTGACCCTTGGTTAGGGGTCCTCTTAGTCCACAAGGTCCGGATGTCACTCATGTACTTAATAACACTTCACCTTCTGTAATACTAAGTCCTCAGAGCTCCATGCTGTTCTGAAAGGGATGGCCACAAGTTCTTTCCCAGCCTCTTCCATTCCCTTTCTTTTCATGCCCATCCCGATGAACCTGCATCATTCCCCGACACTGCCAAGCCAACCCTGGAAAAGGAGTTCGCTGGCCATTGGCTAGAATCAGGGTGGAGAAGTTCCCTGAACCTTCCTGTCTCCCAGGGACATGTATGCTTCCAGGGACAAGCTTAGGTCATGAACATGGTCAGAACCTTTGGACAAGAGGAAAAATACTAAGAGATTTGCTTTTTCTGGGTGCGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGA