Transcript asmbl_142876

Sequence
Transcript Sequence for observation asmbl_142876 of TGE0059591:
CCCGCTGCGGAGTGAACGGTGTGGAGCGGAGGCCGCGGAGGCTCCTCGGTCCTTCAGCACCCCTCGGCCCGACGCACCCACGCCCCTCACCCCCCGAGAGCCGAAAATGGACCCAAGTGGGGTCAAAGTGCTGGAAACAGCAGAGGACATCCAGGAGAGGCGGCAGCAGGTCCTAGACCGATACCACCGCTTCAAGGAACTCTCAACCCTTAGGCGTCAGAAGCTGGAAGATTCCTATCGATTCCAGTTCTTTCAAAGAGATGCTGAAGAGCTGGAGAAATGGATACAGGAAAAACTTCAGATTGCATCTGATGAGAATTATAAAGACCCAACCAACTTGCAGGGAAAGCTTCAGAAGCATCAAGCATTTGAAGCTGAAGTGCAGGCCAACTCAGGAGCCATTGTTAAGCTGGATGAAACTGGAAACCTGATGATCTCAGAAGGGCATTTTGCATCTGAAACCATACGGACCCGTTTGATGGAGCTGCACCGCCAGTGGGAATTACTTTTGGAGAAGATGCGAGAAAAAGGAATCAAACTGCTGCAGGCCCAGAAGTTGGTGCAGTACTTACGAGAATGTGAGGACGTGATGGACTGGATCAATGACAAGGAAGCAATTGTTACTTCTGAAGAGCTGGGCCAGGATCTGGAGCATGTAGAGGTTTTACAGAAGAAATTTGAAGAGTTTCAAACAGATATGGCTGCTCATGAAGAAAGAGTTAATGAAGTGAACCAGTTTGCTGCCAAACTCATACAGGAGCAGCACCCTGAGGAGGAACTGATCAAGACTAAGCAGGATGAAGTCAATGCAGCCTGGCAGCGGCTGAAGGGCCTGGCTCTGCAGAGGCAGGGGAAGCTCTTTGGGGCAGCAGAAGTTCAGCGCTTTAACAGGGATGTGGATGAGACTATCAGTTGGATTAAGGAAAAGGAGCAGTTAATGGCCTCTGATGATTTTGGCCGAGACCTGGCAAGTGTTCAGGCTCTGCTTCGGAAGCACGAGGGTCTGGAGAGAGATCTTGCTGCTCTAGAAGACAAGGTCAAAGCCCTGTGTGCTGAGGCTGACCGCCTGCAACAGTCCCACCCTCTGAGTGCAACACAGATTCAAGTGAAGCGAGAGGAACTGATTACAAACTGGGAGCAGATCCGCACCTTGGCGGCAGAGAGACATGCACGGCTCAATGATTCATACAGGCTTCAACGCTTCCTTGCTGACTTCCGTGACCTCACCAGCTGGGTGACTGAGATGAAAGCCCTCATCAATGCAGATGAGCTTGCCAGTGATGTGGCTGGGGCTGAAGCCCTGCTAGATAGACACCAAGAGCACAAGGGTGAAATTGATGCCCATGAAGACAGCTTCAAATCTGCAGATGAATCTGGACAGGCACTGCTTGCTGCTGGTCACTATGCCTCAGATGAAGTGAGGGAGAAGCTGACCGTCCTTTCCGAGGAGAGAGCGGCGCTGCTGGAGCTGTGGGAGCTGCGCAGGCAGCAGTACGAGCAGTGCATGGACCTGCAGCTCTTCTACCGGGACACTGAGCAGGTGGACAACTGGATGAGCAAGCAGGAGGCGTTCCTGTTGAATGAAGACTTGGGAGATTCCTTGGATAGTGTGGAAGCGCTTCTTAAGAAGCACGAAGACTTTGAGAAATCCCTTAGTGCCCAGGAGGAAAAGATTACAGCATTAGATGAATTTGCAACCAAGCTAATTCAGAACAACCACTATGCAATGGAAGATGTGGCCACTCGCCGAGATGCTCTGTTGAGCCGCCGCAATGCCCTTCACGAGAGAGCCATGCGTCGCCGGGCCCAGCTAGCCGATTCTTTCCATCTGCAGCAGTTTTTCCGTGATTCTGATGAGCTCAAGAGTTGGGTCAATGAGAAGATGAAAACTGCCACAGATGAAGCTTATAAAGATCCATCCAACCTACAAGGAAAAGTACAGAAGCATCAGGCTTTTGAGGCTGAGCTCTCAGCAAACCAGAGCCGAATTGATGCCTTGGAGAAAGCTGGCCAAAAGCTGATTGATGTCAACCACTATGCCAAGGATGAAGTGGCAGCTCGTATGAATGAGGTGATCAGTTTGTGGAAGAAACTGCTAGAGGCCACTGAACTGAAAGGAATAAAGCTTCGTGAAGCCAACCAGCAACAGCAATTTAATCGCAATGTTGAGGATATTGAATTGTGGCTATATGAAGTAGAAGGTCACTTGGCTTCGGATGATTACGGCAAAGATCTTACCAATGTGCAGAACCTCCAGAAGAAACATGCACTGCTAGAGGCAGATGTGGCTGCTCACCAGGACCGAATTGATGGCATCACCATTCAGGCCCGCCAGTTCCAAGATGCTGGCCATTTTGATGCAGAAAACATCAAGAAGAAACAGGAAGCCCTCGTGGCTCGCTATGAGGCACTCAAGGAGCCCATGGTTGCCCGGAAGCAGAAGCTGGCCGATTCTCTGCGGTTGCAGCAGCTCTTCCGGGATGTTGAGGATGAGGAGACGTGGATTCGAGAGAAAGAGCCCATTGCCGCATCTACCAACAGAGGTAAGGATTTAATTGGGGTCCAGAATCTGCTAAAGAAACATCAAGCCTTACAAGCAGAAATTGCTGGACATGAACCACGCATCAAAGCAGTTACACAGAAGGGGAATGCCATGGTGGAGGAAGGCCATTTTGCTGCAGAGGATGTGAAGGCCAAGCTTCACGAGCTGAACCAAAAGTGGGAGGCACTGAAAGCCAAAGCTTCCCAGCGTCGGCAGGACCTGGAGGACTCTCTGCAGGCCCAGCAGTACTTTGCTGATGCTAACGAGGCTGAATCCTGGATGCGGGAGAAGGAACCCATTGTGGGCAGCACTGACTATGGCAAGGACGAAGACTCTGCTGAGGCTCTACTGAAGAAACACGAAGCTTTGATGTCAGATCTCAGTGCCTACGGCAGCAGCATCCAGGCTTTGCGAGAACAAGCACAGTCCTGCCGGCAACAAGTGGCCCCCACGGATGATGAGACTGGGAAGGAGCTGGTCTTGGCTCTCTACGACTATCAGGAGAAGAGTCCCCGAGAGGTCACCATGAAGAAGGGAGATATCCTTACCTTACTCAACAGCACCAACAAGGATTGGTGGAAAGTGGAAGTGAACGATCGTCAGGGTTTTGTGCCGGCTGCGTACGTGAAGAAATTGGACCCCGCCCAGTCAGCCTCCCGGGAGAATCTCCTGGAGGAGCAAGGCAGCATAGCACTGCGGCAGGAGCAGATTGACAATCAGACACGCATAACTAAGGAGGCCGGCAGTGTATCTCTGCGTATGAAGCAGGTGGAAGAACTATATCATTCTCTGCTGGAACTGGGTGAGAAGCGTAAAGGCATGTTGGAGAAGAGTTGCAAGAAGTTTATGTTGTTCCGTGAAGCGAATGAACTACAGCAATGGATCAATGAGAAGGAAGCCGCTCTGACAAGTGAGGAGGTCGGAGCAGACTTGGAGCAGGTTGAGGTGCTCCAGAAGAAGTTTGATGACTTCCAGAAGGACCTGAAGGCCAATGAGTCACGGTTGAAGGACATTAACAAGGTAGCTGAAGACCTGGAGTCTGAAGGTCTCATGGCAGAGGAGGTGCAGGCTGTGCAACAACAGGAAGTGTATGGCATGATGCCCAGGGATGAAACTGATTCCAAGACAGCCTCCCCGTGGAAGTCTGCTCGTCTGATGGTTCACACCGTGGCCACCTTTAATTCCATCAAGGAGCTGAATGAGCGCTGGCGGTCCCTACAGCAGCTGGCCGAGGAACGGAGCCAGCTCTTGGGCAGCGCCCATGAAGTACAGAGGTTCCACAGAGATGCTGATGAAACCAAAGAATGGATTGAAGAGAAGAATCAAGCTCTAAACACAGACAATTATGGACATGATCTCGCCAGTGTCCAGGCCCTGCAACGCAAGCATGAGGGCTTCGAGAGGGACCTTGCGGCTCTCGGTGACAAGGTAAACTCCCTTGGTGAAACAGCAGAGCGCCTGATCCAGTCCCATCCCGAGTCAGCAGAAGACCTGCAGGAAAAGTGCACAGAGTTAAACCAGGCCTGGAGCAGCCTGGGGAAACGTGCAGATCAGCGCAAGGCAAAGTTGGGTGACTCCCACGACCTGCAGCGCTTCCTTAGCGATTTCCGGGACCTCATGTCTTGGATCAATGGAATACGGGGGTTGGTGTCCTCAGATGAGCTAGCCAAGGATGTCACCGGAGCTGAGGCATTGCTGGAGCGACACCAGGAACACCGGACAGAAATCGATGCCAGGGCTGGCACTTTCCAGGCATTTGAGCAGTTTGGACAGCAGCTGTTGGCTCACGGACACTATGCCAGCCCTGAGATCAAGCAGAAACTTGATATTCTTGACCAGGAGCGTGCAGACCTGGAGAAGGCCTGGGTTCAGCGCAGGATGATGCTGGATCAGTGCCTTGAACTGCAGCTGTTCCATCGGGACTGTGAGCAAGCTGAGAACTGGATGGCTGCCCGGGAGGCCTTCTTGAATACCGAAGACAAAGGAGACTCACTGGACAGCGTAGAGGCTCTGATCAAAAAACATGAAGACTTTGACAAAGCGATTAACGTCCAGGAAGAGAAGATTGCTGCTCTGCAGGCCTTTGCCGACCAGCTCATCGCTGCCGGCCATTATGCCAAGGGAGACATTTCTAGCCGGCGCAATGAGGTCTTGGACAGGTGGCGACGTCTGAAAGCCCAGATGATTGAGAAAAGGTCAAAGCTAGGAGAATCTCAAACCCTCCAACAGTTCAGCCGGGATGTGGATGAGATTGAGGCTTGGATCAGTGAAAAATTGCAAACAGCGAGTGATGAGTCGTACAAGGATCCCACCAACATCCAGAGCAAGCACCAGAAGCACCAGGCTTTTGAAGCAGAGCTGCATGCCAACGCTGACCGGATCCGTGGGGTTATCGACATGGGCAACTCCCTCATTGAACGTGGAGCCTGTGCCGGCAGTGAGGATGCTGTCAAGGCCCGCCTGGCTGCCTTAGCTGACCAGTGGCAGTTCTTGGTGCAAAAGTCAGCGGAAAAGAGCCAGAAACTGAAAGAAGCCAACAAGCAGCAGAACTTCAACACAGGGATCAAGGACTTTGACTTCTGGCTGTCTGAGGTGGAGGCCCTGCTGGCATCCGAAGATTATGGCAAAGACCTAGCTTCTGTGAACAACCTGCTGAAAAAGCATCAACTGCTGGAAGCAGATATATCTGCCCATGAGGATCGCCTGAAGGACCTGAACAGCCAGGCAGACAGCCTGATGACCAGCAGTGCCTTCGACACCTCCCAAGTAAAGGACAAGAGGGACACCATCAACGGGCGCTTCCAGAAGATCAAGAGCATGGCGGCCTCCCGGCGAGCCAAGCTGAATGAATCCCATCGCCTGCACCAGTTCTTCCGGGACATGGATGACGAGGAGTCCTGGATCAAGGAGAAGAAGCTGCTGGTGGGCTCAGAGGACTACGGCCGGGACCTAACCGGCGTGCAGAACCTGAGGAAGAAGCACAAGCGGCTGGAAGCAGAACTGGCTGCGCATGAGCCGGCTATTCAGGGTGTCCTGGACACTGGCAAGAAGCTGTCCGATGACAACACCATCGGGAAAGAGGAGATCCAGCAGCGGCTGGCGCAGTTTGTGGAGCACTGGAAAGAGCTGAAGCAGCTGGCAGCTGCCCGGGGTCAGCGGCTGGAAGAGTCCTTGGAATATCAGCAGTTTGTAGCCAATGTGGAAGAGGAAGAAGCCTGGATCAATGAGAAAATGACCCTGGTGGCCAGCGAAGATTATGGCGACACTCTTGCCGCCATCCAGGGCTTACTGAAGAAACATGAAGCTTTTGAGACAGACTTCACCGTCCACAAGGATCGCGTGAATGATGTCTGCACCAATGGACAAGACCTCATTAAGAAGAACAATCACCATGAGGAGAACATCTCTTCAAAGATGAAGGGCCTGAACGGGAAAGTGTCAGACCTGGAGAAAGCTGCAGCCCAGAGAAAGGCGAAGCTGGATGAGAACTCGGCCTTCCTTCAGTTCAACTGGAAGGCGGACGTGGTGGAGTCCTGGATCGGTGAAAAGGAGAACAGCTTGAAGACAGATGATTATGGCCGAGACCTGTCTTCTGTGCAGACGCTCCTCACCAAACAGGAAACTTTTGACGCTGGGCTGCAGGCCTTCCAGCAGGAAGGCATTGCCAACATCACTGCCCTCAAAGATCAGCTTCTCGCCGCCAAACACGTTCAGTCCAAGGCCATCGAGGCCCGGCACGCCTCCCTCATGAAGAGGTGGAGCCAGCTTCTGGCCAACTCAGCCGCCCGCAAGAAGAAGCTTCTGGAGGCTCAGAGTCACTTCCGCAAGGTGGAGGACCTCTTCCTGACCTTCGCCAAAAAGGCTTCTGCCTTCAACAGCTGGTTTGAAAATGCAGAGGAGGACTTAACAGACCCCGTGCGCTGCAACTCCTTGGAAGAAATCAAAGCTTTGCGCGAGGCCCACGACGCCTTCCGCTCCTCCCTCAGCTCTGCCCAGGCTGACTTCAACCAGCTGGCCGAGCTGGACCGCCAGATCAAGAGCTTCCGCGTAGCCTCCAACCCCTACACCTGGTTTACCATGGAGGCCCTGGAGGAGACCTGGAGGAACCTACAGAAAATCATCAAGGAGAGGGAGCTGGAGCTGCAGAAGGAACAGCGGCGGCAGGAGGAGAACGACAAGCTGCGCCAGGAGTTTGCCCAGCACGCCAACGCCTTCCACCAGTGGATCCAAGAGACCAGGTCCTGTATGGTGGAAGAGTCGGGGACCCTCGAATCCCAGCTTGAAGCTACCAAACGCAAGCACCAGGAAATCCGAGCCATGAGAAGTCAGCTCAAAAAGATCGAGGACCTGGGGGCCGCCATGGAGGAGGCCCTCATCCTGGACAACAAGTACACGGAGCACAGCACCGTGGGCCTCGCCCAGCAGTGGGACCAGCTGGACCAGCTGGGCATGCGCATGCAGCACAACCTGGAGCAGCAGATCCAGGCCAGGAACACAACAGGTGTGACTGAGGAGGCCCTCAAAGAATTCAGCATGATGTTTAAACACTTTGACAAGGACAAGTCTGGCAGGCTGAACCATCAGGAGTTCAAATCTTGCCTGCGCTCCCTGGGCTATGACCTGCCCATGGTGGAGGAAGGGGAACCTGACCCTGAGTTCGAGGCAATCCTGGACACGGTGGATCCGAACAGAGATGGCCATGTCTCCTTGCAAGAATACATGGCTTTCATGATCAGCCGCGAAACTGAGAACGTCAAGTCCAGCGAGGAGATTGAGAGCGCCTTCCGGGCCCTCAGCTCAGAGGGAAAGCCTTACGTGACCAAGGAGGAGCTCTACCAGAACCTGACCCGGGAACAAGCCGACTACTGCGTCTCCCACATGAAGCCCTACGTGGACGGCAAGGGCCGCGAGCTCCCCACCGCGTTCGACTACGTGGAGTTCACCCGCTCGCTTTTCGTGAACTGAGCCACTCCCTGGGTCACCCACCCCTCGCTGCTTGCCCTGCGTCGCCTTGCTGCATGTCCGCTCCTCTGTGTGCTCTCACTTTCCACTGTAACCTTAAGCCTGCTTAGCTTGGAATAAGACTTAGGAGAAAATGGTGCTTCACTAACCCGCTTCCGGTCCAGTCACAATCATCATGTCACTGTGGGGACCCAGATCTGTGTCTTGAAGCAGCTGCCCTCATTCCGACTTCAGAAAATCGAAGCAGCTGGCTCCTCCCCTTGTTCTCTCTCCCACCCTCCCCCAAATCTGTTTTCATGTAAAAGACAAATAAATGATGACTTCCCCCA