Transcript asmbl_142474

Sequence
Transcript Sequence for observation asmbl_142474 of TGE0056452:
CTTGTTTCACTTTGTTTTTGGACATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGTATGTTTTGATTCCTCTAATGCCATCCCAACAAATGAAAGTTCTTTTTGCAAGATCTTCAAGGAGAAGAGTTGACTTATTGTATCTATAAATTTAATATGTAAGATTAATTTAATATATTATGGTGTATACTTCATGAGTAAATTGAACTTTCACTGGTAAAATCTACTAGTGAGTTCTCTACTGAAATACTGGGTACATTTTTCAACTAAAGTCATGGAAACATTTAGTTTCCCATGCATAAATTCAGCAAGCAGAATATTCTAGTGTTCCCCCTAGGGTAGATAGACATTGTGGTTTATTTTGCCATTAATATTTGTCAGAGGATTAGAAACTCCTTATTCAAAATATTTATCTTAATTCTATCACATGTAAAATGTTTAAAATTTATGTTCAAATTGTCTCATAAGAATGTTAAAAAATAAGACAAAGAACAGTCAAGGGTTTTGGACTTACTGAAAGGTAGATAACGATTCAAATTTAATTAATTAGTCATATTGGATAACTAAAATCTACCCAGAAAATGTGAGAAAATTACAGGCACTATACATTTCTCTTCTTCTGGTGAGTGAATCAGGTATCTCCTCACATAAGATATGAGATTATATTGTGTTATACTTATTTAATTTTGTGTGATATTTCATTCATAGAAAATAATGGCACTAATATAAAACATAATTAATTCAGAAAAGTTTGTAATCTCAGTCTTGAAGGCTATTGCTTTTTTATGCAATGATAAAAAATCAGTTATCTGTTGTATATATTGTTTAATTAAGTGAATGGTAATGTGTAATCTCATCTACAGCTAAGTCTAAAAATAATTCTTCTATAAGTAAAAAAAAATAGAGAATTATGGTTTCGACTAACATTAAGTATACCTTTTTTTGAATCAACAGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTGGAGGAAACTAAACATTCCCTTGATGGTCTCAAGCTATGATCAGAAGACTTTAATTATATATTTTCATCCTATAAGCTTAAATAGGAAAGTTTCTTCAACAGGATTACAGTGTAGCTACCTACATGCTGAAAAATATAGCCTTTAAATCATTTTTATATTATAACTCTGTATAATAGAGATAAGTCCATTTTTTAAAAATGTTTTCCCCAAACCATAAAACCCTATACAAGTTGTTCTAGTAACAATACATGAGAAAGATGTCTATGTAGCTGAAAATAAAATGACGTCACAAGACAATTGGTGTGTCATTGACTCTTCTATTTTGATT