Transcript asmbl_142471

Sequence
Transcript Sequence for observation asmbl_142471 of TGE0056453:
CTTGTTTCACTTTGTTTTTGGACATAGCTGAGCCATGTACTTCAAACAGAAGGCAGCCAATTACTAACTTCTGGTTGCTAGGTGTGGCTTCCTTTAAAATCCTATAAAATCAGAAGCCCAAGTCTCCACTGCCAGTGTGAAATCTTCAGAGAAGAATTTCTCTTTAGTTCTTTGCAAGAAGGTAGAGATAAAGACACTTTTTCAAAAATGGCAATGGTATCAGAATTCCTCAAGCAGGCCTGGTTTATTGAAAATGAAGAGCAGGAATATGTTCAAACTGTGAAGTCATCCAAAGGTGGTCCCGGATCAGCGGTGAGCCCCTATCCTACCTTCAATCCATCCTCGGATGTCGCTGCCTTGCATAAGGCCATAATGGTTAAAGGTGTGGATGAAGCAACCATCATTGACATTCTAACTAAGCGAAACAATGCACAGCGTCAACAGATCAAAGCAGCATATCTCCAGGAAACAGGAAAGCCCCTGGATGAAACACTGAAGAAAGCCCTTACAGGTCACCTTGAGGAGGTTGTTTTAGCTCTGCTAAAAACTCCAGCGCAATTTGATGCTGATGAACTTCGTGCTGCCATGAAGGGCCTTGGAACTGATGAAGATACTCTAATTGAGATTTTGGCATCAAGAACTAACAAAGAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGCTTTCTCTTGCTAAGGGTGACCGATCTGAGGACTTTGGTGTGAATGAAGACTTGGCTGATTCAGATGCCAGGGTAAGGAAGTGCTTACAAAATACTGCTGCAGTTCATCTTCCTACCTTAAGTGGGGCTACCACATGATCCCCTGTGAAAGCAAATCTAAGATCTTCTGAGAGACCAATGGCTTCTTAATGTTCATTTCCTGAATGAGGCATGTCTTTCTGTAGCCCCCACACACAAAAAAGTAGTCTTTGTAAGTTTTCAATATCTCTCATTATTCGTAAAACCAGAGAGAACTGAAGAAGGACAATACAAATTTGATTTGTCATTCCCAAGAATTGTTTGTTAAAAAAAACTCTGACCTTTCGTTGTACTAGGTATAAGAAGGGGAAATGTAATTTTTTTATTATGTGCAATGGAAAGAGTAAGCATATTTAACGTTATTTTTAACAGAGAACTTTGGAATGGTTTATAGATGTCAATTTATATTGTCAAAATATTACTGCAATGATATAACAAGAGTATAGGATAAATTATAATAATATATGCTTTCTAACATATTGTTTTATTTAGTTTCAGTGACATTGCTGATTATTTATATGCCAAACCACTGGCAACATAAGAAAAATCATATCATTTTAAAGCCTGGAATTTCCATTTAAAACAAACAAACAACTAATATTTGCATTATGCCTTCTCATGGAACAGTATTCTCTAGAGAATTCATTACAGTGCTTCACTAAGGATAGAGATTTCTTTGTGCACCCCCATCCACTTCTGCTATACCAGTACATTATCATGTACATAATAGGCACTCATGAACTTTTTGTTCAACAAATGCATACATATCAGATCAATTTGCTTGAAAAATGCAAAATAATTTTTACATACATTGAAGGTTTTATCATTTTAATAGAAATTGTTCAAGCATATTAAGGAACAAGAGTTAGCATTTGAATAATTGCCCATAATAAAAAATTCTTATTTGCTTTTGACATTTCTGAATTTGCTTTCCATTTTAAGACTATCAGGGTTCTTAATATATATTTATGGAGGTTACATGGATTAGTGTGACCCAAGAGAATGATGGTAGTCAACATTTCAAAGTTAATAAAGACCGCTTGTGACAATAGGGCAGGGATTATATTTTTCATATATAAAAGAAAAAAATCTGTCATTTAGTAAGGTTGATCTATTTGTCTAAGATTATGCAGCTTTGAAATTGCAGAGTCAGAATTTGAATACAGAAATTCTAACATCAAAATGCAAGGTCCAGGTTACGGTTGAATTATTGATTTATAAGTAACATTTGCTGATAATTACTTTGAACAACACAGAGTAAAAAATCTTTAGAGATCCCCTTGGAGTTGTCTTACTATAGAGCATAATCTTAAAGCAATTTAGTTCAGCAAACATTTATTCTGCAAACATATATTCAGACTCTAGTGTTTACAAGGCACCTTGAGAGAAACTGTGGAAGATATTTGACAAACAAAATAAGGTCCCTATCTTTAAAGAACTTGCAATCTTATTGTTGACTACTCTGATTGTATTGGGCACAAAGC