Transcript asmbl_141666

Sequence
Transcript Sequence for observation asmbl_141666 of TGE0002868:
CATCCCCCGGCGGCCTAGGCAGCGTTTCCAGCCCCGAGAACTTTGTTCTTTTTGTCCCGCCCCCTGCGCCCAACCGCCTGCGCCGCCTTCCGGCCCGAGTTCTGGAGACTCAACATGAAGCTACCGGCCAGGGTTTTCTTTACTCTGGGGTCCCGGCTGCCCTGTGGCCTCGCTCCTCGGAGGTTTTTCAGTTATGGGACAAAAATATTATATCAAAACACTGAAGCTTTGCAATCTAAATTCTTTTCACCTCTTCAAAAAGCGATGCTACCACCTAATAGTTTTCAAGGAAAAGTGGCATTCATTACTGGGGGAGGTACTGGCCTTGGTAAAGGAATGACAACTCTTCTGTCCAGCCTAGGTGCTCAGTGCGTGATAGCCAGCCGGAAGATGGATGTTTTGAAAGCTACCGCAGAACAAATTTCTTCTCAAACTGGAAATAAGGTTCATGCAATTCAGTGTGATGTGAGGGATCCTGATATGGTTCAAAACACTGTGTCAGAACTGATCAAAGTTGCAGGACATCCTAATATTGTGATAAACAATGCAGCAGGGAATTTTATTTCTCCTACTGAAAGACTTTCTCCTAATGCTTGGAAAACCATAACTGACATAGTTCTAAATGGCACAGCCTTCGTGACACTAGAAATTGGAAAACAACTAATTAAAGCACAGAAAGGAGCAGCATTTCTTTCTATTACTACTATCTATGCTGAGACTGGTTCAGGTTTTGTAGTACCAAGTGCTTCTGCCAAAGCAGGTGTGGAAGCCATGAGCAAGTCTCTTGCAGCTGAATGGGGTAAATATGGAATGCGATTCAATGTGATTCAACCAGGGCCTATAAAAACCAAAGGTGCCTTTAGCCGTCTGGACCCAACTGGAACATTTGAGAAAGAAATGATTGGCAGAATTCCCTGTGGTCGCCTGGGGACTGTAGAAGAACTCGCAAATCTTGCTGCTTTCCTTTGTAGTGATTATGCTTCTTGGATTAATGGAGCAGTCATTAAATTTGACGGTGGAGAGGAAGTACTTATTTCAGGGGAATTCAACGACCTGAGAAAGGTCACCAAGGAGCAGTGGGACACCATAGAAGAACTCATCAGGAAGACAAAAGGTTCCTAAGACCACTTTGGCCTTCATCTTGGTTACAGAAAAGGGAATAGAAATGAAACAAATTATCTCTCATCTTTTGACTATTTCAAGTCTAATAAATTCTTAATTAACAAA