Transcript asmbl_141665

Sequence
Transcript Sequence for observation asmbl_141665 of TGE0056725:
CATCCCCCGGCGGCCTAGGCAGCGTTTCCAGCCCCGAGAACTTTGTTCTTTTTGTCCCGCCCCCTGCGCCCAACCGCCTGCGCCGCCTTCCGGCCCGAGTTCTGGAGACTCAACATGAAGCTACCGGCCAGGGTTTTCTTTACTCTGGGGTCCCGGCTGCCCTGTGGCCTCGCTCCTCGGAGGGAAGATGGATGTTTTGAAAGCTACCGCAGAACAAATTTCTTCTCAAACTGGAAATAAGGTTCATGCAATTCAGTGTGATGTGAGGGATCCTGATATGGTTCAAAACACTGTGTCAGAACTGATCAAAGTTGCAGGACATCCTAATATTGTGATAAACAATGCAGCAGGGAATTTTATTTCTCCTACTGAAAGACTTTCTCCTAATGCTTGGAAAACCATAACTGACATAGTTCTAAATGGCACAGCCTTCGTGACACTAGAAATTGGAAAACAACTAATTAAAGCACAGAAAGGAGCAGCATTTCTTTCTATTACTACTATCTATGCTGAGACTGGTTCAGGTTTTGTAGTACCAAGTGCTTCTGCCAAAGCAGGTGTGGAAGCCATGAGCAAGTCTCTTGCAGCTGAATGGGGTAAATATGGAATGCGATTCAATGTGATTCAACCAGGGCCTATAAAAACCAAAGGTGCCTTTAGCCGTCTGGACCCAACTGGAACATTTGAGAAAGAAATGATTGGCAGAATTCCCTGTGGTCGCCTGGGGACTGTAGAAGAACTCGCAAATCTTGCTGCTTTCCTTTGTAGTGATTATGCTTCTTGGATTAATGGAGCAGTCATTAAATTTGACGGTGGAGAGGAAGTACTTATTTCAGGGGAATTCAACGACCTGAGAAAGGTCACCAAGGAGCAGTGGGACACCATAGAAGAACTCATCAGGAAGACAAAAGGTTCCTAAGACCACTTTGGCCTTCATCTTGGTTACAGAAAAGGGAATAGAAATGAAACAAATTATCTCTCATCTTTTGACTATTTCAAGTCTAATAAATTCTTAATTAACAAA