Transcript asmbl_141528

Sequence
Transcript Sequence for observation asmbl_141528 of TGE0002857:
GGCGCGGCTGGGGGTGCGAGGCTGCGCAGGCGCGGACGGCGTTGGTTTGAAGACCTTCAGCGTTGCCCTGGCGGAGCAGAGACAGGCCCTCGGGGTGGAGGTCTTTGGTTTCATAAGAGCCTGAGAGAGATTTTTCTAAGATATGTGTAACACACCAACGTACTGTGACCTAGGAAAGGCTGCTAAGGATGTCTTCAACAAAGGATATGGCTTTGGCATGGTCAAGATAGACCTGAAAACCAAGTCTTGTAGTGGAGTGGAATTTTCTACTTCTGGTCATGCTTACACTGATACAGGGAAAGCATCAGGCAACCTAGAAACCAAATATAAGGTCTGTAACTATGGACTTACCTTCACCCAGAAATGGAACACAGACAATACTCTAGGGACAGAAATCTCTTGGGAGAATAAGTTGGCTGAAGGGTTGAAACTGACTCTTGATACCATATTTGTACCGAACACAGGAAAGAAGAGTGGGAAATTGAAGGCCTCCTATAAACGGGATTGTTTTAGTGTTGGCAGTAATGTTGATATAGATTTTTCTGGACCAACCATCTATGGCTGGGCTGTGTTGGCCTTCGAAGGGTGGCTTGCTGGCTATCAGATGAGTTTTGACACAGCCAAATCCAAACTGTCACAGAATAATTTCGCCCTGGGTTACAAGGCTGCGGACTTCCAGCTGCACACACATGTGAACGATGGCACTGAATTTGGAGGTTCTATCTACCAGAAGGTGAATGAGAAGATTGAAACATCCATAAACCTTGCTTGGACAGCTGGGAGTAACAACACCCGTTTTGGCATTGCTGCTAAGTACATGCTGGATTGTAGAACTTCTCTCTCTGCTAAAGTAAATAATGCCAGCCTGATTGGACTGGGTTATACTCAGACCCTTCGACCAGGAGTCAAATTGACTTTATCAGCTTTAATCGATGGGAAGAACTTCAGTGCAGGAGGTCACAAGGTTGGCTTGGGATTTGAACTGGAAGCTTAATGTGGTTTGAGGAAAGCATCAGATTTGTCCCTGGAAGTGAAGAGAAATGAACCCACTATGTTTTGGCCTTAAAATTCTTCTGTGAAATTTCAAAAGTGTGAACTTTTTATTCTTCCAAAGAATTGTAATCCTCCCCACACTGAAGTCTAGGGGTTGCGAATCCCTCCTGAGGGAGATGCTTGAAGGCATGCCTGGAAGTTGTCATGTTTGTGCCACGTTTCAGTTCAGTTCTGAAGTGTTATTAAATGTGTTCCTCAGCGACAGTGTAGCGTCATGTTAGAGGAGACGATCTGACCCACCAGTTTGTACATCACGTCCTGCATGTCCCACACCATTTTTTCATGACCTTGTAATATACTGGTCTCTGTGCTATAGTGGAATCTTTGGTTTTGCATCATAGTAAAATAAAATAAACCCATCACATTTGGAACATAA