Transcript asmbl_140788

Sequence
Transcript Sequence for observation asmbl_140788 of TGE0059084:
GGGTCAAAGAAGCCCTTGGTGTCGTCGCTGGGGTCCGCCAGGACGCGGTTCATCTCCTCACTGAAGTAGCCGCGCTGGTAGGCCACGTCCACAGGCACGCGGTGGCTGTGCACGGGGTCGATGATGCCGCCCGTGGCGATCTGGGCCTCCAGCAGGCGGATGCCGTGCTGCCGGAGAACCAGGCCCTTCTGCATGGCCTGGAAGAGGGAGATGGTGCTGCCCGAGTAGGGGTCTCTGTAGCCGGTGACGGCCTTCTCGGCAGACAGCAGCTGCTCGTGAAGCTCGGGGCCCACCACGCCCGCCTTCACGGCCTCGTGGACATACAGGCGCTGGTTCCGCACGGGGTCCACCAGGAAGCCAGTGGCCGCCTGCGCCTCCAGCAGGAGCGCAGCCGTTGTGGCTCTCAGCAGGCCCCGGCGCATGGCCTCGTAGATGGACACCTTCTCCTTGGTGTCCTCCAGGTAGATGCCGGCGAGGCAGCCACTGCCCTGCAGCAGCGTCCGCACGGAGCCCAGCTCCGAAAGGTCCTTGACCGTCGTCTTGCCGTCCTTGAGCTGCTCAAACTGGGCTCTGCTGAGGACCCCGGAAGCCAGGAGCTCGCTGGCTGGCACAGGGGCACGGAGGCCGCTGAAGGACAGCCTCTCCTGCCGCAGGGTCTCCACCTCCTCCACGATGGTAATGAGAATCTTGATGACCTTCTCCACGGTGACCTTGCCCGTGCGGAACTGACGCAACAGCTCCTGCCGCTGCTCCGCAGTGAAGTACTCAGAGCTGATGAGCTCCCACACCGTCACCGTCCTGCCCTTGAAGCCACCCACGGGGACCTCAACCGGGGTCTTTTCAAAGGTCTCACGGGCCTGCAGCTCTGAGTAGAGCTCCTCCTGCCGGGCCCGAGCAGCCTTTTCTGAGAGCGGCAGCAGGCTCAGCCCGGTCAGCTGGTCGGGCCGGCACCGCTGCTGGAGCTCGCCGTAGGTGGCCGGCTCCCCTGTGCTGGGGTCACTGTAGGCCTTGGCGTCGGCCCTTGGTGCCGACAGGGCCCTGCTGGTCTCCTCATCCAGGCAGCCTCGGGCGCAGGCGACATCCAGGGGCACGCGGTGGCTCTTGCTGGGGTCCACGATGCCGCCCGTGGACAGCTGGGCGTCCAACAGGCGCAGGCCCTGCTCCCGGGGAATGAGGCCCTTCTTCAGGGCCTGGAACAGGGAGACGCTCTGCCCTGTGTAGGGGTCCCTGTACCCTGTCACAGCCTTCTCGGCTGATAGCAGCTTCTCATGAAACTCGGGGCCCACCAGGCCAGCACGCACTGCCTCGTCCACGGTCAGCCGGGCGCTGGTGGCGGGGTCGATGATGTGCCCGGTGCCGGCCTGGGCTTCCAACAGGGCCACGGCCATGTCGGATGGCAGCAGGTCTTTCTTCAGGGCATTGTAGATACTCAGCTTCTGCCCCGCCTCCTCCAGCCATACACCCGCGATGACGTTGGCACCCCGGAGAGCCCGCCGCACAGTGTCCACCTCGGCTACGTCTCGCACAGAGCGCTCACCTCGCTGCAGCTGCTGGTAGAGCTCGCGGTCGATGACCCTGCTCTCCAGCAGCTCGGCGGCTGGCACCAGGCTGCGCAGGCCCTCAAAGCAAAGCCGGCCCTTCTGCTCCTGCTCCTCCACCACCGTGATGATGATCTTGATGATCTTCTCCACTGTGATCCGGCCCGTGCGGAACTGCCGCAGCAGGTCCCGCCGCTGCTCTGCCGTGAAGTATTCCGAGTTGATGATCTCCCAAATGGTCACCGTCTTGCCCTGGAACTTGCCGAACGGCGCAGACACGGTGGCCTTCTCAAAGACGTCCCGGGCCTCGGAGTCAGTGTAGACCAGCTCCCCGCCCTTGGCAGCCTTATCCGTGAGTGGCAGAAGGCACAGGCCCGTCTCGGGGTCCTCCACGCAGCGCTCCAGTAGCTGCAGGTACGTGAGGTTCTCGTGCGTGTTG