Transcript asmbl_140787

Sequence
Transcript Sequence for observation asmbl_140787 of TGE0059589:
GGTTGGAATTGCTTTTATTGGGGGCGGATACCGCAAGGCCCCGCCCACGGTCAGGTTAGTGTTCTGCCCTTGCAGAGGCGCCAGCAGCCTGACACCTCCACCTGCCACCCGCCCGGGGTTAGTGGAACATGCAAAGCTCAGAGGGTGGAGGCAGGGGTGGTCGCTGCTGAGACCAGGGCTGGGTGCAACAGGAGGGTCAGCACAGAGCCTGGCTGGTGTCCCTGGGCCCAAAGGGGGCTGGGGCTCCATGGGAGAGAGACGGGCAGGCGGCACCCCAGTGTGGGGCTCCACAAGCTGGAGGGGCCCCTGGACCCACCAGGAGGACAGGTCTGCAGTTCCCAGCCATGCCGGCTGGAACGTCCGCCTCCCCACTGGGTCTGGGTCCTCGGGGCCTGGGGTTAGAGGCCGACATGGAAGGCACTTACTAGGGGAACAGAGGCTGGAGGCTGACGCCGGAGGCCAGGGGTCTCAGGAGTGAGTGTGGGGGGTGAGCTGGAAAGCACAGATCAGACAGCACTGTGGGGGCTGGGCCCGAGGGCCTCGTCTTCCCATGGGGAAGGGGCTTCTCTGGGTAGACTGGGAGAGAGGCTGACTGGGGCCCCCCGTCCCCAGCAAGGCCCACCGTGCAGGCCAGTGCTAGAAACACCAGGGCCCTCTACAGACAGGGTTGGGCCCAGCTGCCCTGTGCAGCTAGGACTGGCAGGCGGGCTACCCTGGGAAGACAGGAGGGTGGGCTGGGGCCCAGCTTGGGACCCTCCAAGGCACCTGGCTGTGTGAGTGGCAGGTAGAAGGGAGTGAGGAGACCCGAGGGGGTGAGGCGGCCAGCAGGGCTGGGCCAGCCCTGTCCCCCAAGATACAGGCTGTCTGGACAGCAGATATATATTAATATATTAGTCTGGTCTTTTTGGTTAAACTTTAGGCACCACTTGGGAGGAAGACACCTTTAAGCGTTGAAAACGGCCCCCGCGCCTCGGTGGGAGCCGGGCTGGGCCGCATGCAGAGCGGGGTGGGCGCAGGCAGCCTCAGGCCACGGCAGACTCAGGGCCCCCCAGGGAGGCCGAGGACCCCGAGGCGTAGCGGCGGCCGTAGCCCGAGGAGGAGTAGGAGGATGAAGAGAAGGTCATGGAGAAGCCGGAGCCGGTGGCGTCAAAGCTGCCGCGGCGGGAGCCGGCCCGGGAGCCGGTGCGCGAGCCGGTGCGGGAGCCAGCGGTAGAGCCGGAGCCGCTGACGCTGTAGGGGCTGTAGTAGCCCTTGGTGGACTGCGCGGCAGCCTCCAGCAGCCGCAGCCCCGTGCCCTCCTCCACCATGCTGCGGTCCAGCGCGTCCTTATAGGAGATCTTGAGCTTGGTCTTAGGGCAGGTGAGGTACTTGGAGTAGGCGCCCACGTCACGCAGCTTCTGTGCGGTGCGGGCGTCCACCGTGCCGCGCTGCAGGGCCTCGTCCAGGGGCACGCGGCCCGGCGTGTCGGGCTCGATCAAGCCGCCGGTCAGGTACTGCACCTCCAGGAAGCGCTGGCCGGCCTCGTAGTAGAGCCAGCCCTTCTTCAGGGCCTGGGCGGCCGACATCTTGGTCTTGGTGCGTGGGTCCTCGAAGCCGCAGAAGGCCTTCTGGGCCAGGTTGATGCGGTCCACCATGATCTTGTCCACCAGGCCCTTGTTGACGGCGTCGGTGACAGGGAAGCGCTCACCGGTGCTGGGGTCGATGATGCCCCCGGTGCAGGCCTGCGCCTCCAGCAGCCGCTGCCCCGTGATGTTATCCACCAGGTTCCGGTGCATGGCCTCGGTGATGGACACCTTCTCCAGCGTCTCCGTGTCCAGGATGCCAGCCACGGGGCCCGTCTCCTCAGTGGGGTCTGACCAGGAGGCCAGCTGGGTCCTGGAGACGGCGGGGCTGATGGGGTAGGAGGAGGAGGATCCCACCGAGGAGGAACGGGAGCGGAAACCACCGGCGTTGCCCGAGAGCATGTCGGCGAACTCGGTGATGGAGAGCGTGCCGGCGCGGTACTGGTCCAGTGCCGAGCGGTCGATGAGGTTCTTGGCGATGGCATCATCGATGTCGTACTGGCGCCCGGAGCGGCGGTCGATGATCATGGACTTGACCACGCCGTCCGAGGAGGAGATGGTGATCTCCTCCCACTCGCACTCCTGCTCGGACAGCTCCAGGTACGTCTGGTGGTCAATCAGGCCCTTGCGGTAGGCCTCGTACACTGACATCTCCTTGCCCGTCTCGGGGTCCACGATGACCACTCGGCGCTTGCGCACGGAGGACTTGGAGGACGTCTTCCGCTCCCGCTTCTTCTCCTTCAGCGGCAAGAGACACAGGCCCGTCTGGGGGTCAGTGATACAACGCTCCATCAGCTGCAGGTAGGTGAGGTTCTCCTCCGTGTTAGGGTCAAAGAAGCCCTTGGTGTCGTCCGAGGGGTCGGTCAGGATCTCGTTCATCTCCTCATCGAAGAGGCCGCGCTTGTAGGCCACCTCCACGGGCAGCCGGTGGCTCTCCTCAGGGTCGATGATGCCGCCCGTGGCGATCTGGGCCTCCAGCAGGCGGATGCCATGGTCCTTCAGGATCAGGCCCTTCTTCATGGCCTGGAAGAGGGAGATGAGCTTCCCAGAGTAGGGGTCCTTGTACCCAGTGACGGCGCGCTCGGCCGACAGCAGCTTGTCCTTGAACTCGGGGCCCACAATGCCCATACGCACAGCCTCCTCCACCGTCAGCTTCAGTCCCTTGATGGGGTCGATGACGTAACCGGTGGCCGCCTGCGCCTCCAGGAGCTCAAAGGCTGTGCCGGGGCGGATGATGCCCTTCTTCATGGCCTGGTACACCGAGAGCCGTTCCTTGGTGGCGTCCACGAAGACACCAGCGATGCAGCTGGTGCCTTCCAGGAACTTCTGCAAGTTCTTGGTGACCTCCTCGATGGAGGTCAGGCCCTCCCGCAGCTGCAGCGCCGTGGCCTCGTCCATGACCTGCGAGCGCACCAGCTCCTCCATGGTGATCTGCTTCCGCAGGCCACGGAAGGTCAGCTTGCGGGCGTCCGACAGTGGCAGGAGCAGCTGGCCGGTGCCGTCGTCACGACGGCACCGCCTGAGCAGCTGCGTGTAGCTGAGGCGCTCGTCGGTGGACGGGTCCACGTAGCTGCGCACCTCGCTGGGCTCTGACAGCTGGTCGTGCGTGTCCTTGTTGAGGTAGCCACGCTGGTAAGCCACCTCCAGGGGAAGGTGGAAGCCCAGGCGGGGGTCCACGATGCCGCCGGTGGCCAGCTGGGCATCCAGCAGCCGCAGGGCCTCCTCAGTAGGGATCAGCTCCTTCTTCATGGCCTGGAAGAGCGAGATGGTCTGCTCGGTGTAGGGGTCACGGTAGCCGGTGACCGCCCGCTCAGCCGAGAGCAGGCGGTCGTGCAGCTCGGGCCCCACGAGGCCCTTCCGCACAGCCTCATCCACAGTCAGCCGCTCCCCCTTCACCGGGTCCAGCAGGAAGCCTGTGGCTGCCTGTGCCTCCAGCAGCAGGCGGGCCACCTCGGCACTCAGCAGCCCTTTCTTGAGAGCCTGGTAGATGCTCAGTGTCTGCCTGGAACCGGGCAGGTAGACACCAGCCACGGAGCCCGTGCCATAGAGGTAGCACCAGGCGGACTCCGCCTCGAGAGCCTCACGGAGGCTCCTGGTGCCCTCCCGGAGCAGGTTGTAGGTCTCGAGAGAGATGATCCGAGCCTCGAACAGGTCCTCAGCCGTGAGGCGGCGGCGCACGTAGTCGTAGGAGGCCAGACCCTGCTGGCGGATGATCTCTGTCTTCTCAATGATCTCGATGATGATGATGATCATGCGTTCCTTGGTCACCCGGCCGGCCTGGAAGTCAGCCATCAGCTGGGCCCGCTGCTCCTCGGGGATCAGGTCCGACTGCATCACCTCCCACAGGGACATGGTGGAGCCGCCGTGGCTGCCGCCGCCGGGAATGTCGATCTGTGTCTCTTCAAATGCCCTTCTTGTCTCCTCCTCAGTGTACACCTGCGTGGTCTCCACCACCTCAGCCTTCTCCGCCCCTTTCAGTGGCAGAAGGCGCAAGCCCGTCTCGGGGTCCTCCACGCACCGCTCCAGCAGCTGCCTGTACGTGAGGTTCTCA