Transcript asmbl_13909

Sequence
Transcript Sequence for observation asmbl_13909 of TGE0059588:
AAGACTTTAAGGTCATTTACTTGGCAGTTGCATTCAACACATTGTCTTGTTTATTACAGGTCATCATGGTCACAGGAGACCATCCAATCACAGCTAAAGCTATTGCCAAAGGTGTGGGCATCATCTCAGAAGGCAATGAGACCGTGGAAGACATTGCTGCCCGCCTCAACATCCCAGTCAGCCAGGTGAACCCCAGGGATGCCAAGGCCTGCGTAGTACACGGCAGTGATCTAAAGGACATGACCTCCGAGCAGCTGGATGACATTTTGAAGTACCACACTGAGATAGTGTTTGCCAGGACCTCCCCTCAGCAGAAGCTCATCATTGTGGAAGGCTGCCAAAGACAGGGTGCTATCGTGGCTGTGACTGGTGACGGTGTGAATGACTCTCCAGCTTTGAAGAAAGCAGACATTGGGGTTGCTATGGGGATTGCTGGCTCAGATGTGTCCAAGCAAGCTGCTGACATGATTCTTCTGGATGACAACTTTGCCTCAATTGTGACTGGAGTAGAGGAAGGTCGTCTGATCTTTGATAACTTGAAGAAATCCATTGCTTATACCTTAACCAGTAACATTCCCGAGATCACCCCGTTCCTGATATTTATTATTGCAAACATTCCACTACCACTGGGGACTGTCACCATCCTCTGCATTGACTTGGGCACTGACATGGTTCCTGCCATCTCCCTGGCTTATGAGCAGGCTGAGAGTGACATCATGAAGAGACAGCCCAGAAATCCCAAAACAGACAAACTTGTGAATGAGCGGCTGATCAGCATGGCCTATGGGCAGATTGGAATGATCCAGGCCCTGGGAGGCTTCTTTACTTACTTTGTGATTCTGGCTGAGAACGGCTTCCTCCCAATTCACCTGTTGGGCCTCCGAGTGGACTGGGATGACCGCTGGATCAACGATGTGGAAGACAGCTACGGGCAGCAGTGGACCTATGAGCAGAGGAAAATCGTGGAGTTCACCTGCCACACAGCCTTCTTCGTCAGTATCGTGGTGGTGCAGTGGGCCGACTTGGTCATCTGTAAGACCAGGAGGAATTCGGTCTTCCAGCAGGGGATGAAGAACAAGATCTTGATATTTGGCCTCTTTGAAGAGACAGCCCTGGCTGCTTTCCTTTCCTACTGCCCTGGAATGGGTGTTGCTCTTAGGATGTATCCCCTCAAACCTACCTGGTGGTTCTGTGCCTTCCCCTACTCTCTTCTCATCTTCGTATATGACGAAGTCAGAAAACTCATCATCAGGCGACGCCCTGGCGGCTGGGTGGAGAAGGAAACCTACTATTAGCCCCCCGTCCTGCACGCCGTGGAGCATCAGGCCACACACTCTGCATCCGACACCCACCCCCTCTTTGTGTACTTCAGTCTTGGAGTTTGGAACTCTACCCTGGTAGGAAAGCACCGCAGCATGTGGGGAAGCAAGACGTCCTGGAATGAAGCATGTAGCTCTATGGGGGGAGGGGGGAGGGCTGCCTGAAAACCATCCATCTGTGGAAATGACAGCGGGGAAGGTTTTTATGTGCCTTTTTGTTTTTGTAAAAAAGGAACACCCGGAAAGACTGAAAGAATACATTTTATATCTGGATTTTTACAAATAAAGATGGCTATTATAATGGAA